ID: 1068106245

View in Genome Browser
Species Human (GRCh38)
Location 10:52620477-52620499
Sequence GCAGGCAGTAACTATAAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068106242_1068106245 7 Left 1068106242 10:52620447-52620469 CCCAATGGATGGTGAAGTTTACT No data
Right 1068106245 10:52620477-52620499 GCAGGCAGTAACTATAAAGCTGG No data
1068106243_1068106245 6 Left 1068106243 10:52620448-52620470 CCAATGGATGGTGAAGTTTACTG No data
Right 1068106245 10:52620477-52620499 GCAGGCAGTAACTATAAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068106245 Original CRISPR GCAGGCAGTAACTATAAAGC TGG Intergenic
No off target data available for this crispr