ID: 1068106792

View in Genome Browser
Species Human (GRCh38)
Location 10:52628238-52628260
Sequence GATCCCTTTCTTTCAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068106792_1068106794 17 Left 1068106792 10:52628238-52628260 CCTGTCACTGAAAGAAAGGGATC No data
Right 1068106794 10:52628278-52628300 ATAGATCAGCAACCTGGAAGTGG No data
1068106792_1068106793 11 Left 1068106792 10:52628238-52628260 CCTGTCACTGAAAGAAAGGGATC No data
Right 1068106793 10:52628272-52628294 TTTCACATAGATCAGCAACCTGG No data
1068106792_1068106796 22 Left 1068106792 10:52628238-52628260 CCTGTCACTGAAAGAAAGGGATC No data
Right 1068106796 10:52628283-52628305 TCAGCAACCTGGAAGTGGGAAGG No data
1068106792_1068106795 18 Left 1068106792 10:52628238-52628260 CCTGTCACTGAAAGAAAGGGATC No data
Right 1068106795 10:52628279-52628301 TAGATCAGCAACCTGGAAGTGGG No data
1068106792_1068106797 23 Left 1068106792 10:52628238-52628260 CCTGTCACTGAAAGAAAGGGATC No data
Right 1068106797 10:52628284-52628306 CAGCAACCTGGAAGTGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068106792 Original CRISPR GATCCCTTTCTTTCAGTGAC AGG (reversed) Intergenic
No off target data available for this crispr