ID: 1068106793

View in Genome Browser
Species Human (GRCh38)
Location 10:52628272-52628294
Sequence TTTCACATAGATCAGCAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068106792_1068106793 11 Left 1068106792 10:52628238-52628260 CCTGTCACTGAAAGAAAGGGATC No data
Right 1068106793 10:52628272-52628294 TTTCACATAGATCAGCAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068106793 Original CRISPR TTTCACATAGATCAGCAACC TGG Intergenic
No off target data available for this crispr