ID: 1068107397

View in Genome Browser
Species Human (GRCh38)
Location 10:52635871-52635893
Sequence CAGGGTATGAAATATTTTTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068107397_1068107401 2 Left 1068107397 10:52635871-52635893 CCATAAAAATATTTCATACCCTG No data
Right 1068107401 10:52635896-52635918 GTAGGCAAAGTCAATGACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068107397 Original CRISPR CAGGGTATGAAATATTTTTA TGG (reversed) Intergenic
No off target data available for this crispr