ID: 1068118086

View in Genome Browser
Species Human (GRCh38)
Location 10:52756658-52756680
Sequence ATGTGGTTCTTACACTCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068118081_1068118086 17 Left 1068118081 10:52756618-52756640 CCTGCTAAGGCAAACCTATCTGA No data
Right 1068118086 10:52756658-52756680 ATGTGGTTCTTACACTCAGGTGG No data
1068118080_1068118086 25 Left 1068118080 10:52756610-52756632 CCACAGCTCCTGCTAAGGCAAAC No data
Right 1068118086 10:52756658-52756680 ATGTGGTTCTTACACTCAGGTGG No data
1068118082_1068118086 3 Left 1068118082 10:52756632-52756654 CCTATCTGATAGTTCCGCTTTCA No data
Right 1068118086 10:52756658-52756680 ATGTGGTTCTTACACTCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068118086 Original CRISPR ATGTGGTTCTTACACTCAGG TGG Intergenic
No off target data available for this crispr