ID: 1068120407

View in Genome Browser
Species Human (GRCh38)
Location 10:52778532-52778554
Sequence TGGCCGCAGTGGTCGCGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068120400_1068120407 12 Left 1068120400 10:52778497-52778519 CCGGAGCACAGGTGGGCCAGGCA No data
Right 1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG No data
1068120398_1068120407 15 Left 1068120398 10:52778494-52778516 CCTCCGGAGCACAGGTGGGCCAG No data
Right 1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG No data
1068120397_1068120407 16 Left 1068120397 10:52778493-52778515 CCCTCCGGAGCACAGGTGGGCCA No data
Right 1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG No data
1068120396_1068120407 17 Left 1068120396 10:52778492-52778514 CCCCTCCGGAGCACAGGTGGGCC No data
Right 1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG No data
1068120395_1068120407 18 Left 1068120395 10:52778491-52778513 CCCCCTCCGGAGCACAGGTGGGC No data
Right 1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG No data
1068120403_1068120407 -4 Left 1068120403 10:52778513-52778535 CCAGGCAAGCCGCAGGTCCTGGC No data
Right 1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG No data
1068120393_1068120407 19 Left 1068120393 10:52778490-52778512 CCCCCCTCCGGAGCACAGGTGGG No data
Right 1068120407 10:52778532-52778554 TGGCCGCAGTGGTCGCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068120407 Original CRISPR TGGCCGCAGTGGTCGCGCCG CGG Intergenic
No off target data available for this crispr