ID: 1068120624

View in Genome Browser
Species Human (GRCh38)
Location 10:52779424-52779446
Sequence CAAGCACAACACATCCACAT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068120609_1068120624 15 Left 1068120609 10:52779386-52779408 CCTCCTTCCCTCCCTCTTCCCCT No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120617_1068120624 -5 Left 1068120617 10:52779406-52779428 CCTCCTTCCCTCCCTCCTCAAGC No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120616_1068120624 -4 Left 1068120616 10:52779405-52779427 CCCTCCTTCCCTCCCTCCTCAAG No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120618_1068120624 -8 Left 1068120618 10:52779409-52779431 CCTTCCCTCCCTCCTCAAGCACA No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120612_1068120624 7 Left 1068120612 10:52779394-52779416 CCTCCCTCTTCCCCTCCTTCCCT No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120615_1068120624 -3 Left 1068120615 10:52779404-52779426 CCCCTCCTTCCCTCCCTCCTCAA No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120614_1068120624 3 Left 1068120614 10:52779398-52779420 CCTCTTCCCCTCCTTCCCTCCCT No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120603_1068120624 28 Left 1068120603 10:52779373-52779395 CCCTCCCTCTTCCCCTCCTTCCC No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120608_1068120624 16 Left 1068120608 10:52779385-52779407 CCCTCCTTCCCTCCCTCTTCCCC No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120607_1068120624 17 Left 1068120607 10:52779384-52779406 CCCCTCCTTCCCTCCCTCTTCCC No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120613_1068120624 4 Left 1068120613 10:52779397-52779419 CCCTCTTCCCCTCCTTCCCTCCC No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120610_1068120624 12 Left 1068120610 10:52779389-52779411 CCTTCCCTCCCTCTTCCCCTCCT No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120611_1068120624 8 Left 1068120611 10:52779393-52779415 CCCTCCCTCTTCCCCTCCTTCCC No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120606_1068120624 23 Left 1068120606 10:52779378-52779400 CCTCTTCCCCTCCTTCCCTCCCT No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120605_1068120624 24 Left 1068120605 10:52779377-52779399 CCCTCTTCCCCTCCTTCCCTCCC No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data
1068120604_1068120624 27 Left 1068120604 10:52779374-52779396 CCTCCCTCTTCCCCTCCTTCCCT No data
Right 1068120624 10:52779424-52779446 CAAGCACAACACATCCACATCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068120624 Original CRISPR CAAGCACAACACATCCACAT CGG Intergenic
No off target data available for this crispr