ID: 1068121580

View in Genome Browser
Species Human (GRCh38)
Location 10:52786373-52786395
Sequence CAGGCTCAGCCTTCTGGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068121577_1068121580 4 Left 1068121577 10:52786346-52786368 CCTTTGTATTGGTCACTGACTCT No data
Right 1068121580 10:52786373-52786395 CAGGCTCAGCCTTCTGGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068121580 Original CRISPR CAGGCTCAGCCTTCTGGCTG TGG Intergenic
No off target data available for this crispr