ID: 1068124901

View in Genome Browser
Species Human (GRCh38)
Location 10:52827524-52827546
Sequence AGGGAGAGCAAAGTGACTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068124889_1068124901 29 Left 1068124889 10:52827472-52827494 CCCTCCCCCAACAGGCAGTGCAG No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124896_1068124901 6 Left 1068124896 10:52827495-52827517 CCCAGAGAGGCAATCTGTGCACT No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124894_1068124901 22 Left 1068124894 10:52827479-52827501 CCAACAGGCAGTGCAGCCCAGAG No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124892_1068124901 24 Left 1068124892 10:52827477-52827499 CCCCAACAGGCAGTGCAGCCCAG No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124893_1068124901 23 Left 1068124893 10:52827478-52827500 CCCAACAGGCAGTGCAGCCCAGA No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124888_1068124901 30 Left 1068124888 10:52827471-52827493 CCCCTCCCCCAACAGGCAGTGCA No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124897_1068124901 5 Left 1068124897 10:52827496-52827518 CCAGAGAGGCAATCTGTGCACTC No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124891_1068124901 25 Left 1068124891 10:52827476-52827498 CCCCCAACAGGCAGTGCAGCCCA No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data
1068124890_1068124901 28 Left 1068124890 10:52827473-52827495 CCTCCCCCAACAGGCAGTGCAGC No data
Right 1068124901 10:52827524-52827546 AGGGAGAGCAAAGTGACTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068124901 Original CRISPR AGGGAGAGCAAAGTGACTGT GGG Intergenic
No off target data available for this crispr