ID: 1068125807

View in Genome Browser
Species Human (GRCh38)
Location 10:52840711-52840733
Sequence GAATAGGGCAGAAACGCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068125797_1068125807 17 Left 1068125797 10:52840671-52840693 CCCATCTGAGCCTCTAGAACTCC No data
Right 1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG No data
1068125803_1068125807 -7 Left 1068125803 10:52840695-52840717 CCCAGATGCGAGGATGGAATAGG No data
Right 1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG No data
1068125802_1068125807 -4 Left 1068125802 10:52840692-52840714 CCACCCAGATGCGAGGATGGAAT No data
Right 1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG No data
1068125798_1068125807 16 Left 1068125798 10:52840672-52840694 CCATCTGAGCCTCTAGAACTCCA No data
Right 1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG No data
1068125796_1068125807 21 Left 1068125796 10:52840667-52840689 CCTGCCCATCTGAGCCTCTAGAA No data
Right 1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG No data
1068125805_1068125807 -8 Left 1068125805 10:52840696-52840718 CCAGATGCGAGGATGGAATAGGG No data
Right 1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG No data
1068125799_1068125807 7 Left 1068125799 10:52840681-52840703 CCTCTAGAACTCCACCCAGATGC No data
Right 1068125807 10:52840711-52840733 GAATAGGGCAGAAACGCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068125807 Original CRISPR GAATAGGGCAGAAACGCAGC TGG Intergenic
No off target data available for this crispr