ID: 1068128330

View in Genome Browser
Species Human (GRCh38)
Location 10:52867997-52868019
Sequence ACTTATTAACAGGTAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068128326_1068128330 3 Left 1068128326 10:52867971-52867993 CCTGAAAATGTGGAAGTGACTTT 0: 482
1: 1090
2: 1686
3: 1764
4: 1514
Right 1068128330 10:52867997-52868019 ACTTATTAACAGGTAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068128330 Original CRISPR ACTTATTAACAGGTAGAGGT TGG Intergenic
No off target data available for this crispr