ID: 1068128330 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:52867997-52868019 |
| Sequence | ACTTATTAACAGGTAGAGGT TGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068128326_1068128330 | 3 | Left | 1068128326 | 10:52867971-52867993 | CCTGAAAATGTGGAAGTGACTTT | 0: 482 1: 1090 2: 1686 3: 1764 4: 1514 |
||
| Right | 1068128330 | 10:52867997-52868019 | ACTTATTAACAGGTAGAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068128330 | Original CRISPR | ACTTATTAACAGGTAGAGGT TGG | Intergenic | ||
| No off target data available for this crispr | |||||