ID: 1068130594

View in Genome Browser
Species Human (GRCh38)
Location 10:52890332-52890354
Sequence TGGGCACCCATGTCTGAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068130594_1068130602 5 Left 1068130594 10:52890332-52890354 CCTCCTTCAGACATGGGTGCCCA No data
Right 1068130602 10:52890360-52890382 GAAGCCGTGTGTGGTACATCTGG No data
1068130594_1068130600 -4 Left 1068130594 10:52890332-52890354 CCTCCTTCAGACATGGGTGCCCA No data
Right 1068130600 10:52890351-52890373 CCCACAGGGGAAGCCGTGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068130594 Original CRISPR TGGGCACCCATGTCTGAAGG AGG (reversed) Intergenic