ID: 1068130594 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:52890332-52890354 |
Sequence | TGGGCACCCATGTCTGAAGG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1068130594_1068130602 | 5 | Left | 1068130594 | 10:52890332-52890354 | CCTCCTTCAGACATGGGTGCCCA | No data | ||
Right | 1068130602 | 10:52890360-52890382 | GAAGCCGTGTGTGGTACATCTGG | No data | ||||
1068130594_1068130600 | -4 | Left | 1068130594 | 10:52890332-52890354 | CCTCCTTCAGACATGGGTGCCCA | No data | ||
Right | 1068130600 | 10:52890351-52890373 | CCCACAGGGGAAGCCGTGTGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1068130594 | Original CRISPR | TGGGCACCCATGTCTGAAGG AGG (reversed) | Intergenic | ||