ID: 1068134307

View in Genome Browser
Species Human (GRCh38)
Location 10:52936540-52936562
Sequence GAGTTGTTCCATGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068134302_1068134307 11 Left 1068134302 10:52936506-52936528 CCTGTGGAAGGAACAAGCAACTG No data
Right 1068134307 10:52936540-52936562 GAGTTGTTCCATGGAAACACAGG No data
1068134301_1068134307 12 Left 1068134301 10:52936505-52936527 CCCTGTGGAAGGAACAAGCAACT No data
Right 1068134307 10:52936540-52936562 GAGTTGTTCCATGGAAACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068134307 Original CRISPR GAGTTGTTCCATGGAAACAC AGG Intergenic
No off target data available for this crispr