ID: 1068139012

View in Genome Browser
Species Human (GRCh38)
Location 10:52980942-52980964
Sequence AAGTGCCAAGGTAATTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068139012_1068139017 20 Left 1068139012 10:52980942-52980964 CCCATTTAATTACCTTGGCACTT No data
Right 1068139017 10:52980985-52981007 TTTCATTTAAGGATTTATTTTGG No data
1068139012_1068139018 21 Left 1068139012 10:52980942-52980964 CCCATTTAATTACCTTGGCACTT No data
Right 1068139018 10:52980986-52981008 TTCATTTAAGGATTTATTTTGGG No data
1068139012_1068139015 9 Left 1068139012 10:52980942-52980964 CCCATTTAATTACCTTGGCACTT No data
Right 1068139015 10:52980974-52980996 ATCAATTGACCTTTCATTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068139012 Original CRISPR AAGTGCCAAGGTAATTAAAT GGG (reversed) Intergenic
No off target data available for this crispr