ID: 1068146335

View in Genome Browser
Species Human (GRCh38)
Location 10:53075766-53075788
Sequence AGGGTATGGGACTGGCAAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068146335_1068146345 19 Left 1068146335 10:53075766-53075788 CCAATTTGCCAGTCCCATACCCT No data
Right 1068146345 10:53075808-53075830 CCCAGATCAGTATATTCCTTGGG No data
1068146335_1068146343 18 Left 1068146335 10:53075766-53075788 CCAATTTGCCAGTCCCATACCCT No data
Right 1068146343 10:53075807-53075829 CCCCAGATCAGTATATTCCTTGG No data
1068146335_1068146347 20 Left 1068146335 10:53075766-53075788 CCAATTTGCCAGTCCCATACCCT No data
Right 1068146347 10:53075809-53075831 CCAGATCAGTATATTCCTTGGGG No data
1068146335_1068146348 26 Left 1068146335 10:53075766-53075788 CCAATTTGCCAGTCCCATACCCT No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068146335 Original CRISPR AGGGTATGGGACTGGCAAAT TGG (reversed) Intergenic
No off target data available for this crispr