ID: 1068146336

View in Genome Browser
Species Human (GRCh38)
Location 10:53075774-53075796
Sequence AATTGTGGAGGGTATGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068146336_1068146343 10 Left 1068146336 10:53075774-53075796 CCAGTCCCATACCCTCCACAATT No data
Right 1068146343 10:53075807-53075829 CCCCAGATCAGTATATTCCTTGG No data
1068146336_1068146349 25 Left 1068146336 10:53075774-53075796 CCAGTCCCATACCCTCCACAATT No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146336_1068146345 11 Left 1068146336 10:53075774-53075796 CCAGTCCCATACCCTCCACAATT No data
Right 1068146345 10:53075808-53075830 CCCAGATCAGTATATTCCTTGGG No data
1068146336_1068146348 18 Left 1068146336 10:53075774-53075796 CCAGTCCCATACCCTCCACAATT No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146336_1068146347 12 Left 1068146336 10:53075774-53075796 CCAGTCCCATACCCTCCACAATT No data
Right 1068146347 10:53075809-53075831 CCAGATCAGTATATTCCTTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068146336 Original CRISPR AATTGTGGAGGGTATGGGAC TGG (reversed) Intergenic
No off target data available for this crispr