ID: 1068146337

View in Genome Browser
Species Human (GRCh38)
Location 10:53075779-53075801
Sequence AAGAAAATTGTGGAGGGTAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068146337_1068146349 20 Left 1068146337 10:53075779-53075801 CCCATACCCTCCACAATTTTCTT No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146337_1068146343 5 Left 1068146337 10:53075779-53075801 CCCATACCCTCCACAATTTTCTT No data
Right 1068146343 10:53075807-53075829 CCCCAGATCAGTATATTCCTTGG No data
1068146337_1068146347 7 Left 1068146337 10:53075779-53075801 CCCATACCCTCCACAATTTTCTT No data
Right 1068146347 10:53075809-53075831 CCAGATCAGTATATTCCTTGGGG No data
1068146337_1068146345 6 Left 1068146337 10:53075779-53075801 CCCATACCCTCCACAATTTTCTT No data
Right 1068146345 10:53075808-53075830 CCCAGATCAGTATATTCCTTGGG No data
1068146337_1068146348 13 Left 1068146337 10:53075779-53075801 CCCATACCCTCCACAATTTTCTT No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068146337 Original CRISPR AAGAAAATTGTGGAGGGTAT GGG (reversed) Intergenic
No off target data available for this crispr