ID: 1068146348

View in Genome Browser
Species Human (GRCh38)
Location 10:53075815-53075837
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068146337_1068146348 13 Left 1068146337 10:53075779-53075801 CCCATACCCTCCACAATTTTCTT No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146334_1068146348 27 Left 1068146334 10:53075765-53075787 CCCAATTTGCCAGTCCCATACCC No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146339_1068146348 7 Left 1068146339 10:53075785-53075807 CCCTCCACAATTTTCTTAAAAAC No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146341_1068146348 3 Left 1068146341 10:53075789-53075811 CCACAATTTTCTTAAAAACCCCA No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146336_1068146348 18 Left 1068146336 10:53075774-53075796 CCAGTCCCATACCCTCCACAATT No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146340_1068146348 6 Left 1068146340 10:53075786-53075808 CCTCCACAATTTTCTTAAAAACC No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146338_1068146348 12 Left 1068146338 10:53075780-53075802 CCATACCCTCCACAATTTTCTTA No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data
1068146335_1068146348 26 Left 1068146335 10:53075766-53075788 CCAATTTGCCAGTCCCATACCCT No data
Right 1068146348 10:53075815-53075837 CAGTATATTCCTTGGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068146348 Original CRISPR CAGTATATTCCTTGGGGAGA TGG Intergenic
No off target data available for this crispr