ID: 1068146349

View in Genome Browser
Species Human (GRCh38)
Location 10:53075822-53075844
Sequence TTCCTTGGGGAGATGGATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068146339_1068146349 14 Left 1068146339 10:53075785-53075807 CCCTCCACAATTTTCTTAAAAAC No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146338_1068146349 19 Left 1068146338 10:53075780-53075802 CCATACCCTCCACAATTTTCTTA No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146342_1068146349 -8 Left 1068146342 10:53075807-53075829 CCCCAGATCAGTATATTCCTTGG No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146341_1068146349 10 Left 1068146341 10:53075789-53075811 CCACAATTTTCTTAAAAACCCCA No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146344_1068146349 -9 Left 1068146344 10:53075808-53075830 CCCAGATCAGTATATTCCTTGGG No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146346_1068146349 -10 Left 1068146346 10:53075809-53075831 CCAGATCAGTATATTCCTTGGGG No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146336_1068146349 25 Left 1068146336 10:53075774-53075796 CCAGTCCCATACCCTCCACAATT No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146337_1068146349 20 Left 1068146337 10:53075779-53075801 CCCATACCCTCCACAATTTTCTT No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data
1068146340_1068146349 13 Left 1068146340 10:53075786-53075808 CCTCCACAATTTTCTTAAAAACC No data
Right 1068146349 10:53075822-53075844 TTCCTTGGGGAGATGGATTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068146349 Original CRISPR TTCCTTGGGGAGATGGATTT TGG Intergenic
No off target data available for this crispr