ID: 1068148032

View in Genome Browser
Species Human (GRCh38)
Location 10:53096699-53096721
Sequence ACTCATTAACAGAAAGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068148029_1068148032 2 Left 1068148029 10:53096674-53096696 CCAAAAATGTGGAAGCAACTTTG 0: 463
1: 707
2: 921
3: 664
4: 574
Right 1068148032 10:53096699-53096721 ACTCATTAACAGAAAGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068148032 Original CRISPR ACTCATTAACAGAAAGAGGT TGG Intergenic
No off target data available for this crispr