ID: 1068150042

View in Genome Browser
Species Human (GRCh38)
Location 10:53119993-53120015
Sequence GTAGGTATGGCCAGGTGCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068150042_1068150049 29 Left 1068150042 10:53119993-53120015 CCACCGCACCTGGCCATACCTAC No data
Right 1068150049 10:53120045-53120067 CAGAAAGGCAAGTAGCCATTTGG No data
1068150042_1068150048 14 Left 1068150042 10:53119993-53120015 CCACCGCACCTGGCCATACCTAC No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data
1068150042_1068150047 6 Left 1068150042 10:53119993-53120015 CCACCGCACCTGGCCATACCTAC No data
Right 1068150047 10:53120022-53120044 ATGTTAAACAGTGTGAACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068150042 Original CRISPR GTAGGTATGGCCAGGTGCGG TGG (reversed) Intergenic
No off target data available for this crispr