ID: 1068150043

View in Genome Browser
Species Human (GRCh38)
Location 10:53119996-53120018
Sequence AATGTAGGTATGGCCAGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068150043_1068150048 11 Left 1068150043 10:53119996-53120018 CCGCACCTGGCCATACCTACATT No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data
1068150043_1068150047 3 Left 1068150043 10:53119996-53120018 CCGCACCTGGCCATACCTACATT No data
Right 1068150047 10:53120022-53120044 ATGTTAAACAGTGTGAACAAAGG No data
1068150043_1068150049 26 Left 1068150043 10:53119996-53120018 CCGCACCTGGCCATACCTACATT No data
Right 1068150049 10:53120045-53120067 CAGAAAGGCAAGTAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068150043 Original CRISPR AATGTAGGTATGGCCAGGTG CGG (reversed) Intergenic
No off target data available for this crispr