ID: 1068150045

View in Genome Browser
Species Human (GRCh38)
Location 10:53120006-53120028
Sequence TTAACATAAAAATGTAGGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068150045_1068150049 16 Left 1068150045 10:53120006-53120028 CCATACCTACATTTTTATGTTAA No data
Right 1068150049 10:53120045-53120067 CAGAAAGGCAAGTAGCCATTTGG No data
1068150045_1068150047 -7 Left 1068150045 10:53120006-53120028 CCATACCTACATTTTTATGTTAA No data
Right 1068150047 10:53120022-53120044 ATGTTAAACAGTGTGAACAAAGG No data
1068150045_1068150048 1 Left 1068150045 10:53120006-53120028 CCATACCTACATTTTTATGTTAA No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data
1068150045_1068150050 21 Left 1068150045 10:53120006-53120028 CCATACCTACATTTTTATGTTAA No data
Right 1068150050 10:53120050-53120072 AGGCAAGTAGCCATTTGGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068150045 Original CRISPR TTAACATAAAAATGTAGGTA TGG (reversed) Intergenic
No off target data available for this crispr