ID: 1068150046

View in Genome Browser
Species Human (GRCh38)
Location 10:53120011-53120033
Sequence ACTGTTTAACATAAAAATGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068150046_1068150052 29 Left 1068150046 10:53120011-53120033 CCTACATTTTTATGTTAAACAGT No data
Right 1068150052 10:53120063-53120085 TTTGGCCAGGATTTCAGATCTGG No data
1068150046_1068150050 16 Left 1068150046 10:53120011-53120033 CCTACATTTTTATGTTAAACAGT No data
Right 1068150050 10:53120050-53120072 AGGCAAGTAGCCATTTGGCCAGG No data
1068150046_1068150049 11 Left 1068150046 10:53120011-53120033 CCTACATTTTTATGTTAAACAGT No data
Right 1068150049 10:53120045-53120067 CAGAAAGGCAAGTAGCCATTTGG No data
1068150046_1068150048 -4 Left 1068150046 10:53120011-53120033 CCTACATTTTTATGTTAAACAGT No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068150046 Original CRISPR ACTGTTTAACATAAAAATGT AGG (reversed) Intergenic
No off target data available for this crispr