ID: 1068150048

View in Genome Browser
Species Human (GRCh38)
Location 10:53120030-53120052
Sequence CAGTGTGAACAAAGGCAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068150046_1068150048 -4 Left 1068150046 10:53120011-53120033 CCTACATTTTTATGTTAAACAGT No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data
1068150044_1068150048 6 Left 1068150044 10:53120001-53120023 CCTGGCCATACCTACATTTTTAT No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data
1068150042_1068150048 14 Left 1068150042 10:53119993-53120015 CCACCGCACCTGGCCATACCTAC No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data
1068150043_1068150048 11 Left 1068150043 10:53119996-53120018 CCGCACCTGGCCATACCTACATT No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data
1068150045_1068150048 1 Left 1068150045 10:53120006-53120028 CCATACCTACATTTTTATGTTAA No data
Right 1068150048 10:53120030-53120052 CAGTGTGAACAAAGGCAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068150048 Original CRISPR CAGTGTGAACAAAGGCAGAA AGG Intergenic
No off target data available for this crispr