ID: 1068154272

View in Genome Browser
Species Human (GRCh38)
Location 10:53176682-53176704
Sequence TTTTTATAGTCACCAAAGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068154271_1068154272 1 Left 1068154271 10:53176658-53176680 CCTGTACATAAATGTTTATAGCA No data
Right 1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG No data
1068154270_1068154272 11 Left 1068154270 10:53176648-53176670 CCACAAAAAACCTGTACATAAAT No data
Right 1068154272 10:53176682-53176704 TTTTTATAGTCACCAAAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068154272 Original CRISPR TTTTTATAGTCACCAAAGCC TGG Intergenic
No off target data available for this crispr