ID: 1068157376

View in Genome Browser
Species Human (GRCh38)
Location 10:53219207-53219229
Sequence GAGTGCACAAAGGTTATGTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068157374_1068157376 24 Left 1068157374 10:53219160-53219182 CCAGAGTGGAAATTCAAAAACAG No data
Right 1068157376 10:53219207-53219229 GAGTGCACAAAGGTTATGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068157376 Original CRISPR GAGTGCACAAAGGTTATGTT AGG Intergenic
No off target data available for this crispr