ID: 1068163331

View in Genome Browser
Species Human (GRCh38)
Location 10:53296745-53296767
Sequence AGACCCTGCTTCACAAAGAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068163329_1068163331 27 Left 1068163329 10:53296695-53296717 CCTATGTTTAACTTACTCTGTAA No data
Right 1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068163331 Original CRISPR AGACCCTGCTTCACAAAGAT AGG Intergenic
No off target data available for this crispr