ID: 1068168066

View in Genome Browser
Species Human (GRCh38)
Location 10:53357193-53357215
Sequence AGGTGCAGCTCAGAGGGTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068168062_1068168066 25 Left 1068168062 10:53357145-53357167 CCTTAATAACTTGAGTGAGAGTC No data
Right 1068168066 10:53357193-53357215 AGGTGCAGCTCAGAGGGTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068168066 Original CRISPR AGGTGCAGCTCAGAGGGTTC TGG Intergenic
No off target data available for this crispr