ID: 1068170338

View in Genome Browser
Species Human (GRCh38)
Location 10:53384606-53384628
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068170338_1068170340 17 Left 1068170338 10:53384606-53384628 CCCTCACTTGTTTAGAAGGATAT No data
Right 1068170340 10:53384646-53384668 CTGTGATTACATTATTGATTTGG No data
1068170338_1068170341 20 Left 1068170338 10:53384606-53384628 CCCTCACTTGTTTAGAAGGATAT No data
Right 1068170341 10:53384649-53384671 TGATTACATTATTGATTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068170338 Original CRISPR ATATCCTTCTAAACAAGTGA GGG (reversed) Intergenic
No off target data available for this crispr