ID: 1068171825

View in Genome Browser
Species Human (GRCh38)
Location 10:53404191-53404213
Sequence ACCGTGGCTGCCACACTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068171825_1068171830 -4 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171825_1068171836 30 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171836 10:53404244-53404266 TCACAGTAATCTGGCCCTCAGGG 0: 2
1: 8
2: 36
3: 67
4: 196
1068171825_1068171834 21 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171834 10:53404235-53404257 CAGCAGGATTCACAGTAATCTGG No data
1068171825_1068171835 29 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171835 10:53404243-53404265 TTCACAGTAATCTGGCCCTCAGG 0: 2
1: 8
2: 31
3: 57
4: 156
1068171825_1068171831 5 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171831 10:53404219-53404241 GCTAGACCCAGAGGAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068171825 Original CRISPR ACCGTGGCTGCCACACTCCA GGG (reversed) Intergenic
No off target data available for this crispr