ID: 1068171830

View in Genome Browser
Species Human (GRCh38)
Location 10:53404210-53404232
Sequence CGGTGGGCAGCTAGACCCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068171819_1068171830 7 Left 1068171819 10:53404180-53404202 CCCCAGCACCACCCTGGAGTGTG No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171820_1068171830 6 Left 1068171820 10:53404181-53404203 CCCAGCACCACCCTGGAGTGTGG No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171826_1068171830 -5 Left 1068171826 10:53404192-53404214 CCTGGAGTGTGGCAGCCACGGTG No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171822_1068171830 5 Left 1068171822 10:53404182-53404204 CCAGCACCACCCTGGAGTGTGGC No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171816_1068171830 22 Left 1068171816 10:53404165-53404187 CCCTTTGCAAATATTCCCCAGCA No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171825_1068171830 -4 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171817_1068171830 21 Left 1068171817 10:53404166-53404188 CCTTTGCAAATATTCCCCAGCAC No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data
1068171823_1068171830 -1 Left 1068171823 10:53404188-53404210 CCACCCTGGAGTGTGGCAGCCAC No data
Right 1068171830 10:53404210-53404232 CGGTGGGCAGCTAGACCCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068171830 Original CRISPR CGGTGGGCAGCTAGACCCAG AGG Intergenic
No off target data available for this crispr