ID: 1068171834

View in Genome Browser
Species Human (GRCh38)
Location 10:53404235-53404257
Sequence CAGCAGGATTCACAGTAATC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068171823_1068171834 24 Left 1068171823 10:53404188-53404210 CCACCCTGGAGTGTGGCAGCCAC No data
Right 1068171834 10:53404235-53404257 CAGCAGGATTCACAGTAATCTGG No data
1068171825_1068171834 21 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171834 10:53404235-53404257 CAGCAGGATTCACAGTAATCTGG No data
1068171829_1068171834 5 Left 1068171829 10:53404207-53404229 CCACGGTGGGCAGCTAGACCCAG No data
Right 1068171834 10:53404235-53404257 CAGCAGGATTCACAGTAATCTGG No data
1068171822_1068171834 30 Left 1068171822 10:53404182-53404204 CCAGCACCACCCTGGAGTGTGGC No data
Right 1068171834 10:53404235-53404257 CAGCAGGATTCACAGTAATCTGG No data
1068171826_1068171834 20 Left 1068171826 10:53404192-53404214 CCTGGAGTGTGGCAGCCACGGTG No data
Right 1068171834 10:53404235-53404257 CAGCAGGATTCACAGTAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068171834 Original CRISPR CAGCAGGATTCACAGTAATC TGG Intergenic
No off target data available for this crispr