ID: 1068171835

View in Genome Browser
Species Human (GRCh38)
Location 10:53404243-53404265
Sequence TTCACAGTAATCTGGCCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 2, 1: 8, 2: 31, 3: 57, 4: 156}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068171829_1068171835 13 Left 1068171829 10:53404207-53404229 CCACGGTGGGCAGCTAGACCCAG No data
Right 1068171835 10:53404243-53404265 TTCACAGTAATCTGGCCCTCAGG 0: 2
1: 8
2: 31
3: 57
4: 156
1068171825_1068171835 29 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171835 10:53404243-53404265 TTCACAGTAATCTGGCCCTCAGG 0: 2
1: 8
2: 31
3: 57
4: 156
1068171832_1068171835 -5 Left 1068171832 10:53404225-53404247 CCCAGAGGAGCAGCAGGATTCAC 0: 9
1: 20
2: 28
3: 54
4: 271
Right 1068171835 10:53404243-53404265 TTCACAGTAATCTGGCCCTCAGG 0: 2
1: 8
2: 31
3: 57
4: 156
1068171826_1068171835 28 Left 1068171826 10:53404192-53404214 CCTGGAGTGTGGCAGCCACGGTG No data
Right 1068171835 10:53404243-53404265 TTCACAGTAATCTGGCCCTCAGG 0: 2
1: 8
2: 31
3: 57
4: 156
1068171833_1068171835 -6 Left 1068171833 10:53404226-53404248 CCAGAGGAGCAGCAGGATTCACA 0: 8
1: 21
2: 35
3: 52
4: 292
Right 1068171835 10:53404243-53404265 TTCACAGTAATCTGGCCCTCAGG 0: 2
1: 8
2: 31
3: 57
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068171835 Original CRISPR TTCACAGTAATCTGGCCCTC AGG Intergenic
905979481 1:42210889-42210911 TCCACAATAGTCTGGCCCTCAGG + Intronic
907165667 1:52408547-52408569 TTCACTGTCATCTGTCTCTCAGG + Exonic
908891850 1:68857980-68858002 TTCAAAGTAGTCTGGCCTTCAGG - Intergenic
909227613 1:73045231-73045253 ATCATGGTAATCTGGCTCTCTGG + Intergenic
909408100 1:75315717-75315739 TTAAAAGTAAGCTGGCACTCAGG - Intronic
912095259 1:106132888-106132910 TGAGCAGTAATCTGGCCATCTGG - Intergenic
913155360 1:116092053-116092075 TTTACAGTAATCTGGTTCTCAGG - Intergenic
913280638 1:117181866-117181888 GTCACCGTGATCTGGGCCTCAGG + Intronic
913382125 1:118223872-118223894 TTCACAGTAATCTGTTTCCCTGG + Intergenic
915801102 1:158794431-158794453 TTCGTAGTAGTCTGGCCCTCAGG - Intergenic
915959536 1:160253750-160253772 TTCACTGCAATCTCGACCTCTGG - Intronic
919491757 1:198213176-198213198 TTCACAGTAGTCTGGCCTTTAGG + Intronic
923910076 1:238431487-238431509 TTCACAGTAGGCTGGCTCTCAGG + Intergenic
924193277 1:241578438-241578460 TTCACAGTAGTCTAGCTCTCAGG - Intronic
1063328113 10:5125913-5125935 ATCACTGTAGTCTGGCTCTCAGG + Intronic
1068171835 10:53404243-53404265 TTCACAGTAATCTGGCCCTCAGG + Intergenic
1069083734 10:64115737-64115759 TTCTCAGTTATCTGGGTCTCAGG - Intergenic
1070593972 10:77819763-77819785 TTCCCAGTTCTCTGGACCTCAGG + Intronic
1071880969 10:89897948-89897970 TTCACAGTAGTCTGGCCCTTAGG - Intergenic
1074466893 10:113691591-113691613 TTCACAACAGTCTGGCCCTCAGG - Intronic
1076112411 10:127871370-127871392 TTCACAGTAGTCTGGCCTTCAGG - Intergenic
1077268839 11:1665753-1665775 TTCTCAGTTACCTGGCCTTCTGG - Intergenic
1077271914 11:1685427-1685449 TTCTCAGTTACCTGGCCTTCTGG + Intergenic
1078423246 11:11229334-11229356 TGCACAGCAATCTGTCCCTGAGG - Intergenic
1079415847 11:20235710-20235732 ATCACAGCAGTCTGGCTCTCAGG + Intergenic
1079627609 11:22634616-22634638 TTCACAGTAGTTTGGCCCTCAGG - Intronic
1079633996 11:22712454-22712476 GTCACAGGAGTCTGGCTCTCAGG + Intronic
1079763182 11:24356558-24356580 TTCACAGTACTCTGTCCCTCAGG - Intergenic
1079870771 11:25795001-25795023 TTCCCAGTAATCTACCCCTCAGG - Intergenic
1082723374 11:56706160-56706182 TTCACAGTAGTCTGTCCCTGAGG + Intergenic
1083934335 11:65862490-65862512 TTCACAGGAACCTGGTCCTCAGG + Exonic
1085958303 11:81428324-81428346 TTCCCAGGAAACTGACCCTCAGG + Intergenic
1086877333 11:92112339-92112361 TTCACAGTAGTCTTTCTCTCAGG + Intergenic
1087137168 11:94732461-94732483 TTCCCAGTGATCTGGGCCACTGG + Intronic
1087364493 11:97201750-97201772 ATATCAGTAGTCTGGCCCTCAGG - Intergenic
1087640835 11:100752518-100752540 GTCACAGTAGTCTGGCTCTCAGG - Intronic
1088368965 11:109067696-109067718 TGCACAGTATTTTGGACCTCCGG - Intergenic
1088414069 11:109569505-109569527 ATCACTGTAGTCTGGCTCTCAGG - Intergenic
1089288194 11:117420977-117420999 TTCTCTGGAATCTGACCCTCTGG + Intergenic
1091010412 11:131995972-131995994 TTCTCAGGAAACTGACCCTCAGG - Intronic
1093460438 12:19402827-19402849 TTCACAGTAGTCTGGCCCTCAGG - Intergenic
1093534030 12:20201950-20201972 CTCACAGTAGTCTGGCTCACAGG - Intergenic
1093760179 12:22901005-22901027 TTCTCTGTAATCTGGCCTCCTGG + Intergenic
1094497567 12:30998036-30998058 CTCACAGTCATCTGTCCCACTGG + Intergenic
1095554390 12:43483247-43483269 TTCACGGTAGCCTGGCTCTCAGG + Intronic
1096897650 12:54840052-54840074 TTCACAGTAGTCTGACCCTCAGG - Intronic
1098756017 12:74364813-74364835 TTCCCAGGGATCTAGCCCTCAGG + Intergenic
1099163612 12:79275051-79275073 TTCACAGTCTTCTGACCCTAAGG + Intronic
1099598369 12:84699074-84699096 CTCACAGCAATCTTGACCTCTGG + Intergenic
1101235685 12:102787116-102787138 TCCACAGGAACCAGGCCCTCAGG - Intergenic
1102618599 12:114175946-114175968 TTCAGTGTAATTTGTCCCTCTGG - Intergenic
1104773403 12:131378786-131378808 TGCAGAGAAATCTGGTCCTCAGG - Intergenic
1105431729 13:20343247-20343269 TTCATGGTAACCTGGCCCCCAGG + Intergenic
1106432970 13:29699194-29699216 TTTCCAGTAGTCTGGCTCTCAGG + Intergenic
1106512541 13:30423731-30423753 TTCACAAAAATTTGGCCTTCAGG + Intergenic
1106889178 13:34224888-34224910 TTCACTGTGATCTGGCTGTCTGG - Intergenic
1108273190 13:48783120-48783142 TTCACAGTAGTCTGGCCCTGAGG - Intergenic
1108282101 13:48870861-48870883 TTGAGAATAATCTGGCCTTCTGG + Intergenic
1108818803 13:54321055-54321077 TCAACAGTAGTCTGGCCCTCAGG + Intergenic
1109484124 13:62996594-62996616 TTCACAATAATCTGACTCTCAGG - Intergenic
1111164969 13:84447101-84447123 TTCATAGTAGTCTGACCCTCAGG - Intergenic
1111386223 13:87531808-87531830 TTCACAGTAGTGTGCCTCTCAGG + Intergenic
1111547985 13:89769051-89769073 TTCCCAGCCAACTGGCCCTCGGG + Intergenic
1113581476 13:111433140-111433162 TTTTCAGGGATCTGGCCCTCAGG - Intergenic
1114365905 14:22026882-22026904 TTCACAGCAGTCTGGCTCTCAGG + Intergenic
1114697917 14:24644698-24644720 ATCATAGTAGTCTGGCACTCAGG + Intergenic
1121989063 14:98537278-98537300 TTCAGAATAATCTGACCCTGAGG - Intergenic
1127829039 15:62733748-62733770 TTCACAGTATTCTTGCCATCTGG - Intronic
1129413353 15:75361587-75361609 TTCCCAGTAAGCAGGCCCCCGGG - Exonic
1130604959 15:85307524-85307546 TTCACAGTAGTCTGGCTCTCAGG + Intergenic
1132620824 16:867648-867670 TTCACAGGAAGGTGGCCCTGAGG + Intronic
1134302516 16:13004326-13004348 AACACACTGATCTGGCCCTCAGG - Intronic
1137832599 16:51558232-51558254 TTTAGAGAAATCTGACCCTCTGG + Intergenic
1139041592 16:63005153-63005175 TTTACAGTAGTCTGACTCTCAGG - Intergenic
1139170513 16:64625646-64625668 TTCACAGTAGTCCGGACCTCAGG - Intergenic
1144276337 17:13672074-13672096 CTCACAGTAGTCTGGCTCCCAGG + Intergenic
1144445961 17:15329535-15329557 TTCAGAGTAATCTGATGCTCAGG + Intronic
1149089711 17:52763272-52763294 TTCACAGTAGTTTGGCTCTCAGG + Intergenic
1149281896 17:55114484-55114506 TTAACAGTAATATGTCCCTTAGG + Intronic
1203167515 17_GL000205v2_random:111524-111546 ATGACAGTAATATGGCCCTTGGG + Intergenic
1153556171 18:6316296-6316318 TTCACAGTGGTCTGGCTCTCAGG + Intronic
1157507590 18:48239622-48239644 ATCACTGTAGTCTGGCTCTCAGG + Intronic
1166291793 19:41868359-41868381 CTCAGAGTAACCCGGCCCTCAGG + Intronic
1166452229 19:42911707-42911729 ATGACAGAAGTCTGGCCCTCAGG + Intronic
925637926 2:5959943-5959965 TCCACAGTAGCCTGGCCCTCAGG - Intergenic
926833051 2:16986261-16986283 TTCACACAAATCTGTCCCTGAGG - Intergenic
928480157 2:31675307-31675329 TTCACAGTAATCTGGTTCTCAGG - Intergenic
932999314 2:76902216-76902238 TTTACAGCACTCTGGCCCTCTGG + Intronic
936776816 2:115984453-115984475 TTCACAATAGTCTGGCTCTCTGG - Intergenic
936857781 2:116980778-116980800 ATCACTGCAATCTGGCTCTCAGG + Intergenic
936900940 2:117481407-117481429 TTCATAGTATTCTGGCCCTCAGG - Intergenic
937721242 2:125099533-125099555 TTGACAGTCATCTGGCATTCTGG - Intergenic
939018814 2:136933861-136933883 TTCTTAGTAATCTGCCACTCTGG - Intronic
939842013 2:147200814-147200836 TTCTCTGTAATTTTGCCCTCAGG - Intergenic
939919225 2:148087620-148087642 ATCACTGTAGTCTGGCTCTCAGG + Intronic
940131420 2:150387333-150387355 TTCATAGTAATTTGGGCCTCAGG - Intergenic
942297789 2:174534274-174534296 TTCACAGTCATCTCTTCCTCTGG - Intergenic
943782690 2:191842402-191842424 TTCACAGGTAACTGGCCCTGAGG - Intronic
944370277 2:198974243-198974265 TTCACAGTAGTATGGCCCTCAGG + Intergenic
944407049 2:199396763-199396785 TTCACACTAATCAGGCCCAACGG + Intronic
945568298 2:211432042-211432064 TTCACTCTAATCTCGGCCTCAGG - Intronic
946874175 2:224111327-224111349 TTCACAGTAGTCTGGCCCTCAGG + Intergenic
947190391 2:227499181-227499203 TTAACAGTAATCTAGTCATCTGG + Intronic
947333405 2:229054392-229054414 TTCCCAGTCATCTGGTCCTTTGG - Intronic
947674938 2:231970017-231970039 TTCACAGTAGCCTTGACCTCTGG + Intronic
1170708239 20:18765585-18765607 TTCTCTATAATCTGGCCCTGTGG - Intergenic
1172414113 20:34750204-34750226 TTCACCATCATCTGGCCCTGTGG + Exonic
1175618136 20:60420819-60420841 TTCACAGTGGTATGGCCCTCAGG - Intergenic
1176404243 21:6347611-6347633 ATGACAGTAATATGGCCCTTGGG - Intergenic
1176432914 21:6641493-6641515 ATGACAGTAATATGGCCCTTGGG + Intergenic
1176694499 21:9958560-9958582 TTCATACTAGTCTGGCCCTCAGG - Intergenic
1177893459 21:26834021-26834043 TTCACGGTAGTCTGGCCCTCAGG + Intergenic
1181546061 22:23603330-23603352 TTCACAGCAATCTGGGCCCCTGG + Intergenic
950864296 3:16176470-16176492 AGCACAGTATTCTGGCTCTCAGG - Intronic
951299376 3:20975214-20975236 TTTCCAGTAATCTAGCCCTCAGG - Intergenic
951829145 3:26904790-26904812 CTCATTGTAATCTGGGCCTCAGG - Intergenic
954517297 3:51190214-51190236 TTCACAGCAATCTAGCTCTAAGG - Intronic
957281385 3:78155109-78155131 CTCACAGTAGTCTGGCTCCCAGG + Intergenic
957677925 3:83394048-83394070 TTCACAGTAGTCTGGTTTTCAGG + Intergenic
957776309 3:84760270-84760292 ATCACCGTAATCTGGTTCTCAGG + Intergenic
958171845 3:89948268-89948290 TTCACAGTAGTCTGGCCCTCAGG + Intergenic
960163697 3:114378191-114378213 TTCACAGAAATCTGTCCATTTGG - Intronic
960379350 3:116940130-116940152 TTCACAGTAATCTGGCACTAAGG + Intronic
960782127 3:121331060-121331082 TTCACAGTAGTCTGGCCTTCAGG + Intronic
960970813 3:123138894-123138916 TACAGATTAATCTGGTCCTCTGG + Intronic
962336985 3:134542616-134542638 TTCATAGTAATCTCACTCTCTGG + Intronic
962962659 3:140325367-140325389 TTCACATCATACTGGCCCTCTGG - Intronic
964635916 3:158858662-158858684 TTCACAGTAATGTGACTCTCAGG - Intergenic
965929084 3:174019891-174019913 CTCACTAAAATCTGGCCCTCAGG + Intronic
967434816 3:189431615-189431637 TTCACATTAGTCTGTCCCTCAGG + Intergenic
969273101 4:6116229-6116251 ATCACTGTAATCAGCCCCTCTGG + Intronic
971061742 4:22979080-22979102 TTCGCAGTAGTCTGGGTCTCAGG + Intergenic
971504670 4:27353419-27353441 TTCACTGTAATCTCCGCCTCCGG + Intergenic
971721904 4:30255794-30255816 ATAACAGTATTCTGGCTCTCAGG - Intergenic
971802134 4:31306175-31306197 ATCACAGTAATCTAGCTCACAGG - Intergenic
972209914 4:36824170-36824192 TTCACGGTAGTCTGGCCCTCAGG + Intergenic
972232656 4:37093430-37093452 TTCCCAGTGATCTGGCCCTTGGG - Intergenic
972482454 4:39510438-39510460 TGCACAGCTCTCTGGCCCTCTGG + Exonic
974049580 4:56928179-56928201 CTCACTGTAATCTTGCCTTCTGG + Intronic
974310425 4:60201107-60201129 TTCCCAGGAATATGGCCTTCAGG - Intergenic
974485689 4:62502650-62502672 TTCTCAGCAACCTGGCTCTCAGG - Intergenic
974683339 4:65193900-65193922 GTCACAGTACTCTTGCCCTTTGG - Intergenic
974856335 4:67465844-67465866 TTCACAGTAGTCTGGCTCTCAGG + Intergenic
975290953 4:72677910-72677932 TTCACAGTAGTCTGGCTCTCAGG - Intergenic
975374939 4:73632408-73632430 TTCACAGTAGTCTGGCTCTCAGG + Intergenic
976198793 4:82559828-82559850 TTCACTGCAATCTGGCCATTTGG - Intronic
976907932 4:90263240-90263262 ATCACTGTAGTCTGGCTCTCAGG - Intronic
977654381 4:99504537-99504559 TTCATAGTAGTCTGGCTCTAAGG - Intergenic
977771926 4:100870173-100870195 TTCATATTAGTCTGGCCCTCAGG - Intronic
978027537 4:103896428-103896450 TTCACAGTAATCTGGCTCACAGG + Intergenic
979664265 4:123293466-123293488 TTTACAGTAGTCTTGCCCTAAGG - Intronic
980311377 4:131133730-131133752 CTCACAGCAAACTGCCCCTCAGG - Intergenic
980367125 4:131818786-131818808 TTCATACTAGTCTGGCCCTCAGG - Intergenic
980926790 4:139145448-139145470 CTCACAGTAGTCTGGCTCTCAGG + Intronic
982095792 4:151922173-151922195 TTCACTATAATCTGGAACTCCGG - Intergenic
982876165 4:160653218-160653240 TTCACTGTATTGTGGTCCTCTGG + Intergenic
982959260 4:161816050-161816072 TTCACATTACTCTAGCCCACAGG - Intronic
986539524 5:8829019-8829041 TTCACAGTAGTCTGTTCTTCAGG + Intergenic
986916134 5:12623281-12623303 TTCACAGTTGCCTAGCCCTCAGG - Intergenic
989365775 5:40653465-40653487 TTCACAGTAGTCTGGCCCTCAGG + Intergenic
989525932 5:42454033-42454055 GTCACTGCAATCTGGCTCTCAGG - Intronic
993132555 5:83917533-83917555 TTTCCAGAAATCTGGCCTTCAGG - Intergenic
993171932 5:84430636-84430658 TTTACAACATTCTGGCCCTCAGG - Intergenic
993943368 5:94088885-94088907 TTCAGAATAATCTGTCCCTTTGG + Intronic
994372852 5:98986898-98986920 ATCAAAGTAATCTGGATCTCCGG + Intergenic
996823620 5:127657144-127657166 TGCACAGTAATATTGACCTCAGG - Intronic
999992054 5:157058681-157058703 TTCAGAGTAAACTGGGCCTCTGG + Intronic
1002941214 6:1717988-1718010 TACACATTAATCTGGCCCTATGG + Intronic
1004027587 6:11834076-11834098 TTCAAAGTAATCAGGAACTCTGG + Intergenic
1005188099 6:23185205-23185227 TTCACAGTAATCTAGCCTCTTGG + Intergenic
1005395408 6:25377435-25377457 TTCACAGTAGTCTGGACTTCAGG - Intronic
1008180384 6:48320803-48320825 TTCACAGTGACCTGACCCTAAGG - Intergenic
1008872459 6:56288691-56288713 TTCCCAGATAGCTGGCCCTCGGG - Intronic
1008882497 6:56395077-56395099 TTCACAGTAGTCTGGTTCTCAGG + Intergenic
1009389627 6:63130405-63130427 ATCACTGTAGTTTGGCCCTCAGG - Intergenic
1009624791 6:66125962-66125984 TTCTCAGTAGTCTGTCCCTCAGG - Intergenic
1011394573 6:86892386-86892408 CTCACAGTAGTCTGGCTCCCAGG + Intergenic
1012191737 6:96287959-96287981 TTCACAGTAGTCTGGCTCTCAGG + Intergenic
1012829597 6:104187883-104187905 TTCACAGAAATCTGGCCCTCAGG + Intergenic
1013495063 6:110689857-110689879 TTCACAGTAATCTGGCTCTCAGG + Intronic
1016498297 6:144689531-144689553 TTCACAATAGTCTGGCCCTCAGG - Intronic
1020450411 7:8315237-8315259 TTCACAGTACTCTGGTCCTCAGG - Intergenic
1020997424 7:15281032-15281054 TTTACAGTAGTCTGGCTCTCAGG + Intronic
1023413520 7:39910665-39910687 TTCACAGTAGTCCGACCCTCAGG + Intergenic
1023510338 7:40945772-40945794 TTCACAGTAGTTTGGCCCTCAGG - Intergenic
1024893292 7:54227174-54227196 TTCACAGTAGTAGGGCTCTCAGG + Intergenic
1024900626 7:54315213-54315235 TTCACAGTAGTAGGGCTCTCAGG - Intergenic
1027733229 7:81902484-81902506 ATCACTGCAGTCTGGCCCTCAGG - Intergenic
1027838602 7:83278759-83278781 TTCACAGTATTCTGGGTCTCAGG - Intergenic
1028017681 7:85735977-85735999 TTCACAGTAGTCTGGCCCTCAGG + Intergenic
1030255505 7:107505815-107505837 TTCACAGTATTCTTGCCCTTAGG - Intronic
1032950482 7:136903805-136903827 TTAACAGTAATATGGCCTTGGGG + Intronic
1037478921 8:19286378-19286400 TTCACAGTAGTCTAGCTCTCAGG - Intergenic
1038646927 8:29369736-29369758 TTCACTGTAGCCTGGACCTCCGG - Intergenic
1039112134 8:34051857-34051879 ATCACTGTAGTCTGGCTCTCAGG + Intergenic
1039811216 8:41049907-41049929 ATCACTGTAGTCTGGCTCTCAGG + Intergenic
1042084204 8:65089654-65089676 ATCACTGCAATCTGGCTCTCAGG + Intergenic
1042971794 8:74416769-74416791 TTCACAGTATTCTCACCTTCAGG + Intronic
1044224516 8:89704079-89704101 TTCACAGTAGTCTGGCCCTCAGG - Intergenic
1044880213 8:96715808-96715830 TTCACAGTAATCTGGCCCTCAGG - Intronic
1047022156 8:120786201-120786223 TTTCCAGTAGTCTGGCCCTCAGG + Intronic
1047342264 8:123993698-123993720 TTCACTGTAGTTTGGCTCTCAGG - Intronic
1047384266 8:124395027-124395049 TTCACAGTAGTCTGGCTCTCAGG - Intergenic
1047684732 8:127293406-127293428 TTCTCAGGAAACTGACCCTCAGG - Intergenic
1047854917 8:128899025-128899047 TTCACAGGTACCTGGCCCTTAGG + Intergenic
1048517561 8:135124579-135124601 AACACAGTAATCTGGTCCTTGGG - Intergenic
1050054495 9:1637573-1637595 TTCAAAGTCATCTGAGCCTCAGG + Intergenic
1050476374 9:6045346-6045368 TTCACAGTAGTCTGGCCTTCAGG - Intergenic
1051846114 9:21452947-21452969 TTCACTGCAATCTGACCTTCTGG - Intergenic
1051885589 9:21889629-21889651 ATCACTGTAGTCTGGCTCTCAGG - Intronic
1053106785 9:35416351-35416373 TTCACAGTAGTCTGGCTCTCAGG + Intergenic
1053631471 9:39944500-39944522 TTCATACTAGTCTGGCCCTCAGG - Intergenic
1053774293 9:41519030-41519052 TTCATACTAGTCTGGCCCTCAGG + Intergenic
1054212416 9:62306198-62306220 TTCATACTAGTCTGGCCCTCAGG + Intergenic
1054312571 9:63542634-63542656 TTCATACTAGTCTGGCCCTCAGG - Intergenic
1059833976 9:118129319-118129341 TTCACAGTAGTATGGCTCTCAGG + Intergenic
1061194208 9:129098652-129098674 TGCACAGTAAACGGGGCCTCAGG + Intronic
1062399023 9:136364386-136364408 TTCACAGGAAGCGCGCCCTCAGG - Exonic
1203438621 Un_GL000195v1:167177-167199 ATGACAGTAATATGGCCCTTGGG - Intergenic
1188094296 X:26003032-26003054 CTCACAGTAGTCTGGCTCCCAGG + Intergenic
1188790596 X:34404285-34404307 TTCACAGTAGTCTGGTTCCCAGG - Intergenic
1188870498 X:35365312-35365334 TTCACAGTAGTCTGGCTCCAAGG + Intergenic
1188956156 X:36436845-36436867 TTCACAGTAGTCTGGTTATCAGG + Intergenic
1190822524 X:53986850-53986872 TTCACAGCAGTCTTGACCTCCGG - Intronic
1190845987 X:54191080-54191102 TTCACAGTAAACTTGCACTTGGG - Intergenic
1191008574 X:55737695-55737717 TTTGCAGTAGTCTGGCCCTGAGG - Intronic
1192682648 X:73267828-73267850 TTTACAGGAGTCTGGCTCTCAGG + Intergenic
1192727199 X:73765824-73765846 TTCACTGTAATCTGACCCTCAGG - Intergenic
1192886227 X:75337426-75337448 TTCAGAGTAGTCTGGCTCTCAGG - Intergenic
1193077832 X:77374428-77374450 TTCACAGGAATCTGGGACACTGG + Intergenic
1193308298 X:79975296-79975318 TTCATAGTAGTCTGTCCCTAAGG - Intergenic
1193386969 X:80883886-80883908 TTCAAAGTAGTCTGGCTCCCAGG + Intergenic
1193436395 X:81479117-81479139 TTCACAGTAGTCTGGCCCTTGGG + Intergenic
1193608459 X:83597706-83597728 TTCACAGTGATCTCACACTCTGG - Intergenic
1193954566 X:87844051-87844073 ATCACTGCAGTCTGGCCCTCAGG - Intergenic
1194048252 X:89035583-89035605 TTCACAGTAGACTGGCCCTCAGG - Intergenic
1194053323 X:89100165-89100187 ATCACAGTAGTCTCGCTCTCAGG - Intergenic
1194241666 X:91457055-91457077 TTCACAGTAGTCTTGCCCTCAGG + Intergenic
1194335737 X:92644109-92644131 TTCACAGTAGTCTTGCCCTCAGG - Intergenic
1194337560 X:92666353-92666375 TTCATAGTAACCTGGCTCTCAGG + Intergenic
1194384523 X:93236705-93236727 ATCACTGTAGTCTGGCTCTCAGG + Intergenic
1194901802 X:99520969-99520991 TTCACAACAGTCTGGCCCTCAGG + Intergenic
1197049951 X:122046013-122046035 TTCACAATAGTCTGGCCCCCAGG - Intergenic
1197394320 X:125907552-125907574 TTCACAATAGTCCGGTCCTCAGG - Intergenic
1198836869 X:140815186-140815208 ATCACTGTATTCTGGCTCTCAGG - Intergenic
1199065923 X:143418076-143418098 TTAACAGTAGTCTGGCCCTCAGG - Intergenic
1199077134 X:143536766-143536788 CTCACAGTCATCTGGCTCCCAGG + Intergenic
1199241713 X:145554801-145554823 CTCACAGTAGTCTGGCTCTCAGG + Intergenic
1199332721 X:146581371-146581393 CTCACAGTAGTCTGGCTCCCAGG - Intergenic
1200644163 Y:5760860-5760882 TTCACAGTAGTCTTGCACTCAGG - Intergenic
1200645979 Y:5783095-5783117 TTCATAGTAACCTGGCTCTCAGG + Intergenic
1201194197 Y:11475661-11475683 TTCCCAGAAATCTAGTCCTCTGG - Intergenic
1202369805 Y:24188880-24188902 TTCACTGTAGTGTGCCCCTCAGG + Intergenic
1202500979 Y:25481237-25481259 TTCACTGTAGTGTGCCCCTCAGG - Intergenic