ID: 1068171836

View in Genome Browser
Species Human (GRCh38)
Location 10:53404244-53404266
Sequence TCACAGTAATCTGGCCCTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 309
Summary {0: 2, 1: 8, 2: 36, 3: 67, 4: 196}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068171826_1068171836 29 Left 1068171826 10:53404192-53404214 CCTGGAGTGTGGCAGCCACGGTG No data
Right 1068171836 10:53404244-53404266 TCACAGTAATCTGGCCCTCAGGG 0: 2
1: 8
2: 36
3: 67
4: 196
1068171833_1068171836 -5 Left 1068171833 10:53404226-53404248 CCAGAGGAGCAGCAGGATTCACA 0: 8
1: 21
2: 35
3: 52
4: 292
Right 1068171836 10:53404244-53404266 TCACAGTAATCTGGCCCTCAGGG 0: 2
1: 8
2: 36
3: 67
4: 196
1068171825_1068171836 30 Left 1068171825 10:53404191-53404213 CCCTGGAGTGTGGCAGCCACGGT No data
Right 1068171836 10:53404244-53404266 TCACAGTAATCTGGCCCTCAGGG 0: 2
1: 8
2: 36
3: 67
4: 196
1068171832_1068171836 -4 Left 1068171832 10:53404225-53404247 CCCAGAGGAGCAGCAGGATTCAC 0: 9
1: 20
2: 28
3: 54
4: 271
Right 1068171836 10:53404244-53404266 TCACAGTAATCTGGCCCTCAGGG 0: 2
1: 8
2: 36
3: 67
4: 196
1068171829_1068171836 14 Left 1068171829 10:53404207-53404229 CCACGGTGGGCAGCTAGACCCAG No data
Right 1068171836 10:53404244-53404266 TCACAGTAATCTGGCCCTCAGGG 0: 2
1: 8
2: 36
3: 67
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068171836 Original CRISPR TCACAGTAATCTGGCCCTCA GGG Intergenic
902534781 1:17113390-17113412 TCACAGTGGTATGGGCCTCATGG - Intronic
902974540 1:20079583-20079605 TCACTGTAACCTGGACCTCCTGG + Intronic
905979483 1:42210890-42210912 CCACAATAGTCTGGCCCTCAGGG + Intronic
908891849 1:68857979-68858001 TCAAAGTAGTCTGGCCTTCAGGG - Intergenic
909415525 1:75401827-75401849 TAACAGTATTCTGGGCATCATGG + Intronic
911258522 1:95660549-95660571 TCACAGTATTCTGGCTCTTCAGG - Intergenic
913155359 1:116092052-116092074 TTACAGTAATCTGGTTCTCAGGG - Intergenic
914999982 1:152580104-152580126 TCACAGCAATCTGTCCCTGGTGG - Intronic
915801101 1:158794430-158794452 TCGTAGTAGTCTGGCCCTCAGGG - Intergenic
917967956 1:180190412-180190434 TCACACTCATGTGTCCCTCAGGG + Exonic
918317238 1:183332169-183332191 TAACAGAAAGCTGGCCCTCCTGG - Intronic
918363234 1:183780341-183780363 TCAAAGTTAATTGGCCCTCAGGG + Intronic
918469722 1:184859754-184859776 TCACAGTAATCTGGTGAGCATGG - Intronic
919491758 1:198213177-198213199 TCACAGTAGTCTGGCCTTTAGGG + Intronic
922317588 1:224456483-224456505 TCACAGTAGCCTGGACCTCCCGG + Intronic
923910077 1:238431488-238431510 TCACAGTAGGCTGGCTCTCAGGG + Intergenic
924193276 1:241578437-241578459 TCACAGTAGTCTAGCTCTCAGGG - Intronic
1064499209 10:15950640-15950662 TCACATTAATCTGGCCCAAATGG + Intergenic
1064879210 10:20031293-20031315 TCACTGCAGCCTGGCCCTCATGG - Intronic
1065355323 10:24834920-24834942 TCACTGTAGTCTGACTCTCAGGG + Intergenic
1065439827 10:25740300-25740322 TCACAGTCTTCTGGCCTTCATGG - Intergenic
1065707010 10:28479591-28479613 TCACAGCTGCCTGGCCCTCAGGG + Intergenic
1065962532 10:30745561-30745583 TCACTGTAATCTCTGCCTCATGG + Intergenic
1068171836 10:53404244-53404266 TCACAGTAATCTGGCCCTCAGGG + Intergenic
1069028349 10:63568728-63568750 TCACTGTAGCCTGGACCTCATGG + Intronic
1070028028 10:72650605-72650627 TCACTGTAATCTCTGCCTCATGG - Intergenic
1070320387 10:75350620-75350642 TCACTGTAATCTGGAGCTCCTGG + Intergenic
1070398046 10:76029968-76029990 TCACTGTAGCCTGGCCCTCCTGG + Intronic
1070593973 10:77819764-77819786 TCCCAGTTCTCTGGACCTCAGGG + Intronic
1070597114 10:77840302-77840324 TCACTGTAATCTCGACCTCTTGG - Intronic
1071091899 10:81928894-81928916 TCACTGCAACCTGGCCCTCCAGG + Intronic
1071880968 10:89897947-89897969 TCACAGTAGTCTGGCCCTTAGGG - Intergenic
1072159945 10:92756851-92756873 TCTCAGTAGTCTGGGCTTCAGGG + Intergenic
1073666919 10:105543977-105543999 TCCCAGTATTCTTGTCCTCATGG - Intergenic
1074466892 10:113691590-113691612 TCACAACAGTCTGGCCCTCAGGG - Intronic
1074578863 10:114697039-114697061 TCACAGTAATCTGAATCTCTCGG + Intergenic
1075270224 10:121043019-121043041 ACACAGCAATCTGGCCCACTCGG - Intergenic
1075757331 10:124823990-124824012 TCACTGTAGCCTGGCCCTCCTGG + Intronic
1076112410 10:127871369-127871391 TCACAGTAGTCTGGCCTTCAGGG - Intergenic
1078106855 11:8363166-8363188 CCCCAGTAATCCGGCCCTCCTGG - Intergenic
1078295793 11:10068792-10068814 TCACAGCATTGTTGCCCTCAAGG + Intronic
1079627608 11:22634615-22634637 TCACAGTAGTTTGGCCCTCAGGG - Intronic
1079763181 11:24356557-24356579 TCACAGTACTCTGTCCCTCAGGG - Intergenic
1080978003 11:37365153-37365175 TCATAGTAGTCTGGCCCTCAAGG + Intergenic
1081683148 11:45022908-45022930 TCACAGGAATCAGGACCCCATGG - Intergenic
1082723375 11:56706161-56706183 TCACAGTAGTCTGTCCCTGAGGG + Intergenic
1084134470 11:67166257-67166279 TCACTGTAATCTCTCCCTCCTGG + Intronic
1085703316 11:78764143-78764165 TCACAGCAAGCTGGCCACCAGGG - Intronic
1086364711 11:86097044-86097066 TCACTGTAATCTGGAACTCCTGG + Intergenic
1086877334 11:92112340-92112362 TCACAGTAGTCTTTCTCTCAGGG + Intergenic
1087640834 11:100752517-100752539 TCACAGTAGTCTGGCTCTCAGGG - Intronic
1088108428 11:106231165-106231187 TCAAAGTCATCTTACCCTCATGG + Intergenic
1089010662 11:115129275-115129297 TCACAGATATCTAGTCCTCATGG - Intergenic
1090167853 11:124570305-124570327 TCTCAGCAATCTGTCACTCATGG + Exonic
1092338582 12:7655903-7655925 TCACAGTAACCTGGAACTCCTGG - Intronic
1093266976 12:17015575-17015597 TCACAGGAGTCTGGCCTTCAAGG - Intergenic
1093460437 12:19402826-19402848 TCACAGTAGTCTGGCCCTCAGGG - Intergenic
1093534029 12:20201949-20201971 TCACAGTAGTCTGGCTCACAGGG - Intergenic
1094838387 12:34332840-34332862 TCACATTAGGCTGGCCCCCATGG - Intergenic
1095554391 12:43483248-43483270 TCACGGTAGCCTGGCTCTCAGGG + Intronic
1095786175 12:46110729-46110751 TCACAGTAGTCTGGTCCTCAAGG + Intergenic
1096416096 12:51415234-51415256 TCACAGTAATGCTGGCCTCATGG + Intronic
1096897649 12:54840051-54840073 TCACAGTAGTCTGACCCTCAGGG - Intronic
1098756018 12:74364814-74364836 TCCCAGGGATCTAGCCCTCAGGG + Intergenic
1099163613 12:79275052-79275074 TCACAGTCTTCTGACCCTAAGGG + Intronic
1099598370 12:84699075-84699097 TCACAGCAATCTTGACCTCTGGG + Intergenic
1099736520 12:86573606-86573628 TCACATTATTGTTGCCCTCATGG - Intronic
1100646064 12:96532693-96532715 TCACTGTAACCTGGACCTCCTGG + Intronic
1102981764 12:117247330-117247352 TCAAGGTAATCTGGATCTCATGG - Exonic
1106072519 13:26426178-26426200 TCACAGCAATCCAGCCCTCAAGG + Intergenic
1106432971 13:29699195-29699217 TTCCAGTAGTCTGGCTCTCAGGG + Intergenic
1107793924 13:44030835-44030857 TCACTGTGCTCTGGCCCTCCAGG + Intergenic
1108273189 13:48783119-48783141 TCACAGTAGTCTGGCCCTGAGGG - Intergenic
1109001578 13:56811891-56811913 TCACAGCAGTCTGGCTCCCAGGG + Intergenic
1109427185 13:62180117-62180139 TCAAAAAAATCTGGCACTCAAGG + Intergenic
1109814244 13:67559049-67559071 TCAAAGTAATATTGGCCTCATGG - Intergenic
1110209282 13:72953379-72953401 TCACAGTAGTCTGGCCCTCCAGG - Intronic
1110699017 13:78525392-78525414 TCTCACTAAGCTTGCCCTCATGG - Intergenic
1111477299 13:88767846-88767868 TCACAGTAATGCTGGCCTCATGG - Intergenic
1114365906 14:22026883-22026905 TCACAGCAGTCTGGCTCTCAGGG + Intergenic
1114439152 14:22732303-22732325 CCAGAGTGAACTGGCCCTCAGGG - Intergenic
1114697918 14:24644699-24644721 TCATAGTAGTCTGGCACTCAGGG + Intergenic
1114838576 14:26234290-26234312 TCACATTTATGAGGCCCTCATGG + Intergenic
1119857042 14:77908598-77908620 TCACTGTAATCTGGAACTCCTGG + Intronic
1124350481 15:28951961-28951983 TCACTGTAATCTCCACCTCATGG + Intronic
1124417148 15:29481375-29481397 TCAGAGTAGTAAGGCCCTCAGGG + Intronic
1126869259 15:52970269-52970291 CCACACTAGTCTGTCCCTCAAGG + Intergenic
1127837773 15:62804614-62804636 TCACACTAATGAGGCCCTCATGG - Intronic
1128075227 15:64821644-64821666 TCACTGTAACCTGGGCCTCATGG + Intronic
1129335475 15:74849897-74849919 TCACTGTGATCTAGCCCTCAAGG - Intronic
1130604960 15:85307525-85307547 TCACAGTAGTCTGGCTCTCAGGG + Intergenic
1131039787 15:89253436-89253458 TCACTGTAATCTGAACCTCGTGG - Intronic
1131192619 15:90329164-90329186 TCACAGTAGTCTTGACCTCCTGG + Intergenic
1131413742 15:92233159-92233181 TTACAGCAGTCTGGCTCTCAAGG + Intergenic
1131820913 15:96272629-96272651 TGACATCATTCTGGCCCTCATGG + Intergenic
1132620825 16:867649-867671 TCACAGGAAGGTGGCCCTGAGGG + Intronic
1134852920 16:17496466-17496488 TCACAGTAACCTCGACCTCTTGG + Intergenic
1135074036 16:19377857-19377879 TCACAGTAATCTTGAACTCCTGG - Intergenic
1135428390 16:22360043-22360065 TCAAAGTAGTCTGGCCTTCAAGG - Intronic
1135493085 16:22926638-22926660 TCAGATGAACCTGGCCCTCATGG + Intergenic
1135665282 16:24330419-24330441 TCACAAAAAACTTGCCCTCAGGG - Intronic
1137398712 16:48135631-48135653 TCAGAAAAATCTGGACCTCATGG - Intronic
1138544813 16:57710974-57710996 TCACAGTAATGCTGGCCTCATGG + Intronic
1138565751 16:57831613-57831635 TCACAGTAGCCTGGACCTCCTGG - Intronic
1139170512 16:64625645-64625667 TCACAGTAGTCCGGACCTCAGGG - Intergenic
1140150875 16:72363999-72364021 TCACTGTAATCTGGAACTCCTGG + Intergenic
1140517948 16:75557754-75557776 TCACTGTAATCTGTGCCTCCCGG - Intergenic
1141100241 16:81192401-81192423 TCACTGCAATCTGCCCCTCCCGG + Intergenic
1143809206 17:9457037-9457059 TCACAGAAATGTGTCTCTCATGG + Intronic
1144276338 17:13672075-13672097 TCACAGTAGTCTGGCTCCCAGGG + Intergenic
1144445962 17:15329536-15329558 TCAGAGTAATCTGATGCTCAGGG + Intronic
1147678106 17:42221053-42221075 TCAGAGTGACGTGGCCCTCAGGG - Intronic
1147687843 17:42297885-42297907 TCAGAGTGACGTGGCCCTCAGGG + Intronic
1149089712 17:52763273-52763295 TCACAGTAGTTTGGCTCTCAGGG + Intergenic
1149281897 17:55114485-55114507 TAACAGTAATATGTCCCTTAGGG + Intronic
1150052074 17:61974327-61974349 TCACTGTAACCTTGACCTCATGG - Intronic
1150059573 17:62054224-62054246 TCACTGTAATCTCTCCCTCTTGG - Intronic
1153556172 18:6316297-6316319 TCACAGTGGTCTGGCTCTCAGGG + Intronic
1154075581 18:11197601-11197623 TCAGAGTAATGTTGACCTCATGG + Intergenic
1163205224 19:15797637-15797659 TCACCCTGACCTGGCCCTCAGGG - Intergenic
1163458460 19:17422511-17422533 TCTCACCAATCTGACCCTCAAGG + Intronic
1163724006 19:18912219-18912241 TCACTGTAATCTTGACCTCCTGG + Intronic
1166447770 19:42872892-42872914 TGACGGAAGTCTGGCCCTCATGG + Intronic
1166452230 19:42911708-42911730 TGACAGAAGTCTGGCCCTCAGGG + Intronic
1168661615 19:58171915-58171937 TCACTGTAATCTCCCCCTCCCGG + Intergenic
925213868 2:2075398-2075420 TCACAGTCATCTGGACCCCTAGG + Intronic
925637924 2:5959942-5959964 CCACAGTAGCCTGGCCCTCAGGG - Intergenic
926242735 2:11100957-11100979 TGACTGTCATCTGGGCCTCAAGG + Intergenic
926545326 2:14233277-14233299 TCACTGAAATCTGGACCTCAAGG + Intergenic
928480156 2:31675306-31675328 TCACAGTAATCTGGTTCTCAGGG - Intergenic
933349660 2:81137307-81137329 TCACAGTAGACTGGCTCTCATGG + Intergenic
936900939 2:117481406-117481428 TCATAGTATTCTGGCCCTCAGGG - Intergenic
938409686 2:131053798-131053820 TCACTGTAGTCTGGAACTCATGG - Intronic
940131419 2:150387332-150387354 TCATAGTAATTTGGGCCTCAGGG - Intergenic
940366147 2:152851320-152851342 TTACAGTAGTCTGGCTCCCAGGG - Intergenic
940862563 2:158785853-158785875 TCACAGTAATCTTGAACTCCTGG - Intergenic
942840844 2:180359342-180359364 TCACAGTAGTCTGGTGTTCAAGG - Intergenic
944813408 2:203350422-203350444 TCACTGTAATCTGGAACTCATGG + Intronic
945521593 2:210833992-210834014 TCACAGCAGTCTGGCCCTCAAGG - Intergenic
945800646 2:214425773-214425795 AGACAGAAATCTGACCCTCAAGG + Intronic
946568934 2:220999846-220999868 TCACTGTAGCCTGGCCCTCTTGG + Intergenic
946874176 2:224111328-224111350 TCACAGTAGTCTGGCCCTCAGGG + Intergenic
1171134956 20:22687756-22687778 TTACAGCAATCTGCCCCTCATGG - Intergenic
1173772768 20:45677666-45677688 TCACTGTCATCTGGTCATCAGGG + Intergenic
1175618135 20:60420818-60420840 TCACAGTGGTATGGCCCTCAGGG - Intergenic
1176694498 21:9958559-9958581 TCATACTAGTCTGGCCCTCAGGG - Intergenic
1177679669 21:24349980-24350002 TGCCAGCAATCTGGCTCTCAGGG - Intergenic
1177685602 21:24433876-24433898 TCACAGTAACCTGGAACTCCTGG - Intergenic
1177884498 21:26732297-26732319 TCACAGTAGGCTGGTGCTCAGGG - Intergenic
1177893460 21:26834022-26834044 TCACGGTAGTCTGGCCCTCAGGG + Intergenic
1178003352 21:28189449-28189471 TCAGGGTAATCTGGGCCTCATGG + Intergenic
1180727155 22:17954819-17954841 TCACAGCAACCTCGCCCTCCCGG + Intronic
1181546062 22:23603331-23603353 TCACAGCAATCTGGGCCCCTGGG + Intergenic
1181641800 22:24204954-24204976 TCACAGTAGCCTGGACCTCCTGG + Intergenic
1182503946 22:30768600-30768622 TCACTGCAATCTGGGCCTCCCGG - Intronic
1182534438 22:30990013-30990035 GCCCAGTAATCTAGCCCTGATGG + Intergenic
1183188678 22:36307492-36307514 TAATAGTAATCTGGCCGTGAAGG - Intronic
1184544797 22:45160239-45160261 TCACAGTCCTTTGGCTCTCAGGG + Intergenic
949249272 3:1963094-1963116 TCACAGTAAGCTGGCCATTTTGG - Intergenic
950463543 3:13139823-13139845 ACACTCTAATCTGGCCCACATGG - Intergenic
951299375 3:20975213-20975235 TTCCAGTAATCTAGCCCTCAGGG - Intergenic
951817170 3:26767059-26767081 TCACAGTTATCTAGCCCTTTAGG - Intergenic
953414923 3:42710182-42710204 TCACAGCAATCTGCGCCTCCAGG + Intronic
954517296 3:51190213-51190235 TCACAGCAATCTAGCTCTAAGGG - Intronic
957281386 3:78155110-78155132 TCACAGTAGTCTGGCTCCCAGGG + Intergenic
957567870 3:81908019-81908041 TCACTGCAACCTGCCCCTCATGG + Intergenic
958171846 3:89948269-89948291 TCACAGTAGTCTGGCCCTCAGGG + Intergenic
958841537 3:99210698-99210720 CCTCAGAAATCTGGCCTTCAGGG + Intergenic
959403615 3:105933573-105933595 TCACAGTCATCTAGCCCACATGG - Intergenic
960379351 3:116940131-116940153 TCACAGTAATCTGGCACTAAGGG + Intronic
960782128 3:121331061-121331083 TCACAGTAGTCTGGCCTTCAGGG + Intronic
960799525 3:121523638-121523660 TCACTGTAATCTCTACCTCATGG - Intronic
964142692 3:153421743-153421765 TCACAGCAACCTTGCCCTCTTGG - Intergenic
964635915 3:158858661-158858683 TCACAGTAATGTGACTCTCAGGG - Intergenic
966374082 3:179277778-179277800 TCACTGTCTTCTGGCACTCATGG - Intergenic
967434817 3:189431616-189431638 TCACATTAGTCTGTCCCTCAGGG + Intergenic
968675304 4:1875034-1875056 TCACTGTAACCTGGCACTCCTGG + Intronic
971061743 4:22979081-22979103 TCGCAGTAGTCTGGGTCTCAGGG + Intergenic
971660733 4:29411506-29411528 CCACTGAAATCTAGCCCTCAGGG + Intergenic
971721903 4:30255793-30255815 TAACAGTATTCTGGCTCTCAGGG - Intergenic
972209915 4:36824171-36824193 TCACGGTAGTCTGGCCCTCAGGG + Intergenic
974049581 4:56928180-56928202 TCACTGTAATCTTGCCTTCTGGG + Intronic
974075270 4:57163312-57163334 TCACAGTAAAGTGGGCCTCCAGG - Intergenic
974485688 4:62502649-62502671 TCTCAGCAACCTGGCTCTCAGGG - Intergenic
974677053 4:65105329-65105351 TCACAGTAATGCTGGCCTCATGG - Intergenic
974856336 4:67465845-67465867 TCACAGTAGTCTGGCTCTCAGGG + Intergenic
975290952 4:72677909-72677931 TCACAGTAGTCTGGCTCTCAGGG - Intergenic
975374940 4:73632409-73632431 TCACAGTAGTCTGGCTCTCAGGG + Intergenic
976537071 4:86229984-86230006 TCACAGCAGTCTCGACCTCATGG - Intronic
977654380 4:99504536-99504558 TCATAGTAGTCTGGCTCTAAGGG - Intergenic
977771925 4:100870172-100870194 TCATATTAGTCTGGCCCTCAGGG - Intronic
978027538 4:103896429-103896451 TCACAGTAATCTGGCTCACAGGG + Intergenic
978508765 4:109492428-109492450 TCACATTAATCTAGAGCTCATGG - Intronic
979664264 4:123293465-123293487 TTACAGTAGTCTTGCCCTAAGGG - Intronic
980218124 4:129877814-129877836 AAACAGAAATCTTGCCCTCATGG - Intergenic
980367124 4:131818785-131818807 TCATACTAGTCTGGCCCTCAGGG - Intergenic
980926791 4:139145449-139145471 TCACAGTAGTCTGGCTCTCAGGG + Intronic
981380656 4:144067874-144067896 TCACATTAAGATTGCCCTCAAGG - Intergenic
981838509 4:149083022-149083044 TCACTGGGAGCTGGCCCTCAGGG - Intergenic
982845404 4:160246446-160246468 TCACAGTAGTCTAGCCCTCATGG - Intergenic
984125921 4:175810460-175810482 TGACAGAAATCTTCCCCTCACGG + Intronic
986539525 5:8829020-8829042 TCACAGTAGTCTGTTCTTCAGGG + Intergenic
986553745 5:8988587-8988609 TCACAGTAATGCTGGCCTCATGG + Intergenic
986916133 5:12623280-12623302 TCACAGTTGCCTAGCCCTCAGGG - Intergenic
988033775 5:25798718-25798740 TCAGAGAAACCTGGCTCTCATGG - Intergenic
989365776 5:40653466-40653488 TCACAGTAGTCTGGCCCTCAGGG + Intergenic
990380556 5:55218464-55218486 ACACAAAAATCTTGCCCTCATGG - Intergenic
990527606 5:56643234-56643256 TCACTGTAATCTTGACCTCCTGG - Intergenic
993171931 5:84430635-84430657 TTACAACATTCTGGCCCTCAGGG - Intergenic
994295154 5:98081341-98081363 TGACAGAAATCTGGCCACCAGGG + Intergenic
996823619 5:127657143-127657165 GCACAGTAATATTGACCTCAGGG - Intronic
997174915 5:131765145-131765167 TCACTGCAATCTGGACCTCCTGG - Intronic
998505760 5:142670739-142670761 TCACAGTTATTTGGACTTCAGGG + Intronic
998534917 5:142920839-142920861 CCCCAGTATTCTGGCCCTCCAGG - Intronic
1001801033 5:174544297-174544319 TCACAGTTATCTGGCTCCAAAGG + Intergenic
1005395407 6:25377434-25377456 TCACAGTAGTCTGGACTTCAGGG - Intronic
1005649649 6:27875014-27875036 TCACTGCAATCTCCCCCTCACGG + Intergenic
1007962483 6:45972921-45972943 TCATAGTAATCTGGCCCTACTGG + Intronic
1008882498 6:56395078-56395100 TCACAGTAGTCTGGTTCTCAGGG + Intergenic
1009614800 6:65990674-65990696 TTACAGTAATCTGGCCGGCAAGG + Intergenic
1009624790 6:66125961-66125983 TCTCAGTAGTCTGTCCCTCAGGG - Intergenic
1010637813 6:78282674-78282696 CCACAGTAGTCTGGCTCCCAGGG - Intergenic
1011394574 6:86892387-86892409 TCACAGTAGTCTGGCTCCCAGGG + Intergenic
1012079449 6:94736820-94736842 TCACAGTAGTCTGGCTTCCAGGG + Intergenic
1012191738 6:96287960-96287982 TCACAGTAGTCTGGCTCTCAGGG + Intergenic
1012829598 6:104187884-104187906 TCACAGAAATCTGGCCCTCAGGG + Intergenic
1013495064 6:110689858-110689880 TCACAGTAATCTGGCTCTCAGGG + Intronic
1013985461 6:116187098-116187120 TCACTGCAGTCTGGCTCTCAGGG - Intronic
1015538388 6:134290073-134290095 TCACTGTAACCTCCCCCTCACGG - Intronic
1015630875 6:135230692-135230714 TCCCAGTAATCTTGTCCACAGGG + Intergenic
1016014514 6:139170229-139170251 TGACAATAATCTGTCCATCATGG - Intronic
1016498296 6:144689530-144689552 TCACAATAGTCTGGCCCTCAGGG - Intronic
1016646208 6:146411428-146411450 TCTAAGTAATCTGGCCCTAGAGG - Intronic
1017375215 6:153760740-153760762 TCACAGTAGTCTAGCTTTCAGGG + Intergenic
1020450410 7:8315236-8315258 TCACAGTACTCTGGTCCTCAGGG - Intergenic
1020997425 7:15281033-15281055 TTACAGTAGTCTGGCTCTCAGGG + Intronic
1021115285 7:16739863-16739885 TCACAGTAACCTCGACCTCCAGG - Intergenic
1023357071 7:39377993-39378015 TGCCAGCAATCTGCCCCTCAAGG + Intronic
1023413521 7:39910666-39910688 TCACAGTAGTCCGACCCTCAGGG + Intergenic
1023510337 7:40945771-40945793 TCACAGTAGTTTGGCCCTCAGGG - Intergenic
1023524059 7:41080389-41080411 ACACAGGAATCTGACCTTCAGGG + Intergenic
1024128922 7:46330257-46330279 TCACAGTAACCTCCCCCTCCTGG + Intergenic
1024893293 7:54227175-54227197 TCACAGTAGTAGGGCTCTCAGGG + Intergenic
1024900625 7:54315212-54315234 TCACAGTAGTAGGGCTCTCAGGG - Intergenic
1026781763 7:73272898-73272920 TCACAGTAATCTCTGCCTCCTGG + Intergenic
1027022613 7:74826332-74826354 TCACAGTAATCTCTGCCTCCTGG + Intronic
1027065399 7:75119577-75119599 TCACAGTAATCTCTGCCTCCTGG - Intronic
1027808354 7:82859338-82859360 TCACAGTGATGTTGCCCACAGGG + Intronic
1027838601 7:83278758-83278780 TCACAGTATTCTGGGTCTCAGGG - Intergenic
1028017682 7:85735978-85736000 TCACAGTAGTCTGGCCCTCAGGG + Intergenic
1028048780 7:86157637-86157659 TCACTGTAACCTGGAACTCATGG + Intergenic
1028529999 7:91828073-91828095 TCACAGTAGTCTCGACCTCCTGG + Intronic
1030255504 7:107505814-107505836 TCACAGTATTCTTGCCCTTAGGG - Intronic
1034778704 7:153856618-153856640 TCACAGTAAACTGCCCCATAGGG - Intergenic
1035854372 8:2958513-2958535 TCACAGGAATCTGCCCCTCAAGG - Intronic
1036827310 8:11987363-11987385 TCACAGTGACCTGGCTCCCAGGG + Intergenic
1037292791 8:17368947-17368969 ACACAGTAATTTCCCCCTCAGGG + Intronic
1037478920 8:19286377-19286399 TCACAGTAGTCTAGCTCTCAGGG - Intergenic
1038019650 8:23541992-23542014 TCACAGTAATGTGGCTCCCAAGG + Intronic
1039542574 8:38383280-38383302 GCACAGTGATCTGGCCCTGCAGG + Intergenic
1042510384 8:69605048-69605070 TCTCAGTGAGCTTGCCCTCAAGG - Intronic
1042971795 8:74416770-74416792 TCACAGTATTCTCACCTTCAGGG + Intronic
1044224515 8:89704078-89704100 TCACAGTAGTCTGGCCCTCAGGG - Intergenic
1044362655 8:91306782-91306804 TCACAGTAACCTGGAACTCCAGG + Intronic
1044514111 8:93118770-93118792 ACACAGTCAGCTGGCCTTCAGGG - Intergenic
1044880212 8:96715807-96715829 TCACAGTAATCTGGCCCTCAGGG - Intronic
1045753830 8:105517835-105517857 TCACTGCAATCTGGACCTCCTGG - Intronic
1046522152 8:115339334-115339356 TCACTGCAATCTTGCCCTCCAGG + Intergenic
1047022157 8:120786202-120786224 TTCCAGTAGTCTGGCCCTCAGGG + Intronic
1047342263 8:123993697-123993719 TCACTGTAGTTTGGCTCTCAGGG - Intronic
1047384265 8:124395026-124395048 TCACAGTAGTCTGGCTCTCAGGG - Intergenic
1047634301 8:126743822-126743844 TCATAGTAGTCTGGCTCCCAGGG - Intergenic
1048831034 8:138477722-138477744 TCAGACTGAACTGGCCCTCATGG - Intronic
1049209255 8:141377787-141377809 TGACAGAAATCTGCCCCTGAAGG - Intergenic
1050476373 9:6045345-6045367 TCACAGTAGTCTGGCCTTCAGGG - Intergenic
1050560434 9:6829346-6829368 CCACAGAAATCTGCCCCTCTAGG - Intronic
1053106786 9:35416352-35416374 TCACAGTAGTCTGGCTCTCAGGG + Intergenic
1053631470 9:39944499-39944521 TCATACTAGTCTGGCCCTCAGGG - Intergenic
1053774294 9:41519031-41519053 TCATACTAGTCTGGCCCTCAGGG + Intergenic
1054212417 9:62306199-62306221 TCATACTAGTCTGGCCCTCAGGG + Intergenic
1054312570 9:63542633-63542655 TCATACTAGTCTGGCCCTCAGGG - Intergenic
1056675656 9:88674931-88674953 ACACAGAAATCTGACCATCATGG - Intergenic
1057760166 9:97866668-97866690 TCAGAGAAATATTGCCCTCATGG + Intergenic
1059833977 9:118129320-118129342 TCACAGTAGTATGGCTCTCAGGG + Intergenic
1186598282 X:11007938-11007960 TAAGAGTAATCTGGCCCTAGTGG + Intergenic
1188094297 X:26003033-26003055 TCACAGTAGTCTGGCTCCCAGGG + Intergenic
1188790595 X:34404284-34404306 TCACAGTAGTCTGGTTCCCAGGG - Intergenic
1188870499 X:35365313-35365335 TCACAGTAGTCTGGCTCCAAGGG + Intergenic
1188956157 X:36436846-36436868 TCACAGTAGTCTGGTTATCAGGG + Intergenic
1191008573 X:55737694-55737716 TTGCAGTAGTCTGGCCCTGAGGG - Intronic
1192599961 X:72451724-72451746 AGAAAGTAATCTCGCCCTCATGG - Intronic
1192682649 X:73267829-73267851 TTACAGGAGTCTGGCTCTCAGGG + Intergenic
1192727198 X:73765823-73765845 TCACTGTAATCTGACCCTCAGGG - Intergenic
1192776218 X:74248282-74248304 TCACTGTAATCTCGACCTCCTGG - Intergenic
1192886226 X:75337425-75337447 TCAGAGTAGTCTGGCTCTCAGGG - Intergenic
1193265563 X:79464304-79464326 TCAGAAGAATCTGGCACTCAAGG - Intergenic
1193308297 X:79975295-79975317 TCATAGTAGTCTGTCCCTAAGGG - Intergenic
1193580008 X:83252519-83252541 ACTCATTAGTCTGGCCCTCAGGG + Intergenic
1193995781 X:88364869-88364891 TCACAGTAGTCTGGCCTTTGAGG + Intergenic
1194048251 X:89035582-89035604 TCACAGTAGACTGGCCCTCAGGG - Intergenic
1194335736 X:92644108-92644130 TCACAGTAGTCTTGCCCTCAGGG - Intergenic
1194337561 X:92666354-92666376 TCATAGTAACCTGGCTCTCAGGG + Intergenic
1197049950 X:122046012-122046034 TCACAATAGTCTGGCCCCCAGGG - Intergenic
1197394319 X:125907551-125907573 TCACAATAGTCCGGTCCTCAGGG - Intergenic
1199065922 X:143418075-143418097 TAACAGTAGTCTGGCCCTCAGGG - Intergenic
1199077135 X:143536767-143536789 TCACAGTCATCTGGCTCCCAGGG + Intergenic
1199332720 X:146581370-146581392 TCACAGTAGTCTGGCTCCCAGGG - Intergenic
1199382298 X:147184280-147184302 TCAAAGCAATCTCGCCATCAAGG + Intergenic
1200644162 Y:5760859-5760881 TCACAGTAGTCTTGCACTCAGGG - Intergenic