ID: 1068183658

View in Genome Browser
Species Human (GRCh38)
Location 10:53556327-53556349
Sequence ATTGAGAAGCCTAATTGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068183651_1068183658 27 Left 1068183651 10:53556277-53556299 CCATCTCTTTAAAGGGACTGTGT No data
Right 1068183658 10:53556327-53556349 ATTGAGAAGCCTAATTGAGAAGG No data
1068183656_1068183658 -6 Left 1068183656 10:53556310-53556332 CCACAGAACTCCTTAATATTGAG No data
Right 1068183658 10:53556327-53556349 ATTGAGAAGCCTAATTGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068183658 Original CRISPR ATTGAGAAGCCTAATTGAGA AGG Intergenic
No off target data available for this crispr