ID: 1068185237

View in Genome Browser
Species Human (GRCh38)
Location 10:53576721-53576743
Sequence GCACACCAAACAATAAAGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068185236_1068185237 17 Left 1068185236 10:53576681-53576703 CCTCATAGAGAGTTATTATTGCT No data
Right 1068185237 10:53576721-53576743 GCACACCAAACAATAAAGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068185237 Original CRISPR GCACACCAAACAATAAAGCA CGG Intergenic
No off target data available for this crispr