ID: 1068186473

View in Genome Browser
Species Human (GRCh38)
Location 10:53592639-53592661
Sequence AGACCAACTCCACAACTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068186473_1068186474 2 Left 1068186473 10:53592639-53592661 CCAATCAGTTGTGGAGTTGGTCT No data
Right 1068186474 10:53592664-53592686 TCACATAATTTTATATTTCCTGG No data
1068186473_1068186475 5 Left 1068186473 10:53592639-53592661 CCAATCAGTTGTGGAGTTGGTCT No data
Right 1068186475 10:53592667-53592689 CATAATTTTATATTTCCTGGAGG No data
1068186473_1068186476 6 Left 1068186473 10:53592639-53592661 CCAATCAGTTGTGGAGTTGGTCT No data
Right 1068186476 10:53592668-53592690 ATAATTTTATATTTCCTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068186473 Original CRISPR AGACCAACTCCACAACTGAT TGG (reversed) Intergenic