ID: 1068196738

View in Genome Browser
Species Human (GRCh38)
Location 10:53727022-53727044
Sequence AAGGGGAGTTCAGCCAGGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068196738_1068196747 13 Left 1068196738 10:53727022-53727044 CCGCCCCTGGCTGAACTCCCCTT No data
Right 1068196747 10:53727058-53727080 TCTTCTCTGTTTCTCTCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068196738 Original CRISPR AAGGGGAGTTCAGCCAGGGG CGG (reversed) Intergenic
No off target data available for this crispr