ID: 1068198374

View in Genome Browser
Species Human (GRCh38)
Location 10:53748164-53748186
Sequence CGGGCTAAGGATACGGGCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068198374_1068198381 2 Left 1068198374 10:53748164-53748186 CCACTGCCCGTATCCTTAGCCCG No data
Right 1068198381 10:53748189-53748211 GTAACCACTGATCTGTTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068198374 Original CRISPR CGGGCTAAGGATACGGGCAG TGG (reversed) Intergenic
No off target data available for this crispr