ID: 1068205095

View in Genome Browser
Species Human (GRCh38)
Location 10:53840066-53840088
Sequence TCCTTGTTCTTAAGTACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068205091_1068205095 25 Left 1068205091 10:53840018-53840040 CCTTGAGCAAGAGTGAGGAGCTG 0: 1
1: 0
2: 2
3: 29
4: 302
Right 1068205095 10:53840066-53840088 TCCTTGTTCTTAAGTACAAAAGG No data
1068205090_1068205095 26 Left 1068205090 10:53840017-53840039 CCCTTGAGCAAGAGTGAGGAGCT 0: 1
1: 0
2: 0
3: 7
4: 143
Right 1068205095 10:53840066-53840088 TCCTTGTTCTTAAGTACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068205095 Original CRISPR TCCTTGTTCTTAAGTACAAA AGG Intronic
No off target data available for this crispr