ID: 1068207050

View in Genome Browser
Species Human (GRCh38)
Location 10:53868974-53868996
Sequence GTGTCTACAAAGAATTAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2310
Summary {0: 1, 1: 7, 2: 217, 3: 744, 4: 1341}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068207050_1068207053 -1 Left 1068207050 10:53868974-53868996 CCTGGCTAATTCTTTGTAGACAC 0: 1
1: 7
2: 217
3: 744
4: 1341
Right 1068207053 10:53868996-53869018 CAGGGTCTCGCTATGTTGCCTGG 0: 34
1: 329
2: 1824
3: 5991
4: 13916
1068207050_1068207055 4 Left 1068207050 10:53868974-53868996 CCTGGCTAATTCTTTGTAGACAC 0: 1
1: 7
2: 217
3: 744
4: 1341
Right 1068207055 10:53869001-53869023 TCTCGCTATGTTGCCTGGGCTGG 0: 26
1: 524
2: 5991
3: 48877
4: 159199
1068207050_1068207054 0 Left 1068207050 10:53868974-53868996 CCTGGCTAATTCTTTGTAGACAC 0: 1
1: 7
2: 217
3: 744
4: 1341
Right 1068207054 10:53868997-53869019 AGGGTCTCGCTATGTTGCCTGGG 0: 56
1: 1333
2: 12236
3: 51917
4: 133875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068207050 Original CRISPR GTGTCTACAAAGAATTAGCC AGG (reversed) Intronic
Too many off-targets to display for this crispr