ID: 1068207053

View in Genome Browser
Species Human (GRCh38)
Location 10:53868996-53869018
Sequence CAGGGTCTCGCTATGTTGCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22094
Summary {0: 34, 1: 329, 2: 1824, 3: 5991, 4: 13916}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068207050_1068207053 -1 Left 1068207050 10:53868974-53868996 CCTGGCTAATTCTTTGTAGACAC 0: 1
1: 7
2: 217
3: 744
4: 1341
Right 1068207053 10:53868996-53869018 CAGGGTCTCGCTATGTTGCCTGG 0: 34
1: 329
2: 1824
3: 5991
4: 13916
1068207049_1068207053 7 Left 1068207049 10:53868966-53868988 CCACTACGCCTGGCTAATTCTTT 0: 5
1: 755
2: 22451
3: 87535
4: 173826
Right 1068207053 10:53868996-53869018 CAGGGTCTCGCTATGTTGCCTGG 0: 34
1: 329
2: 1824
3: 5991
4: 13916

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068207053 Original CRISPR CAGGGTCTCGCTATGTTGCC TGG Intronic
Too many off-targets to display for this crispr