ID: 1068207054

View in Genome Browser
Species Human (GRCh38)
Location 10:53868997-53869019
Sequence AGGGTCTCGCTATGTTGCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 199417
Summary {0: 56, 1: 1333, 2: 12236, 3: 51917, 4: 133875}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068207050_1068207054 0 Left 1068207050 10:53868974-53868996 CCTGGCTAATTCTTTGTAGACAC 0: 1
1: 7
2: 217
3: 744
4: 1341
Right 1068207054 10:53868997-53869019 AGGGTCTCGCTATGTTGCCTGGG 0: 56
1: 1333
2: 12236
3: 51917
4: 133875
1068207049_1068207054 8 Left 1068207049 10:53868966-53868988 CCACTACGCCTGGCTAATTCTTT 0: 5
1: 755
2: 22451
3: 87535
4: 173826
Right 1068207054 10:53868997-53869019 AGGGTCTCGCTATGTTGCCTGGG 0: 56
1: 1333
2: 12236
3: 51917
4: 133875

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068207054 Original CRISPR AGGGTCTCGCTATGTTGCCT GGG Intronic
Too many off-targets to display for this crispr