ID: 1068207054 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:53868997-53869019 |
| Sequence | AGGGTCTCGCTATGTTGCCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 199417 | |||
| Summary | {0: 56, 1: 1333, 2: 12236, 3: 51917, 4: 133875} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1068207050_1068207054 | 0 | Left | 1068207050 | 10:53868974-53868996 | CCTGGCTAATTCTTTGTAGACAC | 0: 1 1: 7 2: 217 3: 744 4: 1341 |
||
| Right | 1068207054 | 10:53868997-53869019 | AGGGTCTCGCTATGTTGCCTGGG | 0: 56 1: 1333 2: 12236 3: 51917 4: 133875 |
||||
| 1068207049_1068207054 | 8 | Left | 1068207049 | 10:53868966-53868988 | CCACTACGCCTGGCTAATTCTTT | 0: 5 1: 755 2: 22451 3: 87535 4: 173826 |
||
| Right | 1068207054 | 10:53868997-53869019 | AGGGTCTCGCTATGTTGCCTGGG | 0: 56 1: 1333 2: 12236 3: 51917 4: 133875 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1068207054 | Original CRISPR | AGGGTCTCGCTATGTTGCCT GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||