ID: 1068210994

View in Genome Browser
Species Human (GRCh38)
Location 10:53920262-53920284
Sequence TCTAATGTTTTATAGGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 271}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068210994_1068210996 7 Left 1068210994 10:53920262-53920284 CCATACACCTATAAAACATTAGA 0: 1
1: 0
2: 1
3: 23
4: 271
Right 1068210996 10:53920292-53920314 ATAAAAAGTGAAAAGTGTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068210994 Original CRISPR TCTAATGTTTTATAGGTGTA TGG (reversed) Intronic
906350415 1:45054105-45054127 TCTAATTTTTTGTAGAGGTAGGG - Intronic
907715312 1:56921087-56921109 TCTAAGGTTTTATAGGTAGTGGG + Intergenic
908812933 1:68002663-68002685 TCTCATGGTTTAAAAGTGTATGG - Intergenic
909544157 1:76825486-76825508 TCTAGTGTTCTATAGGTGCATGG + Intergenic
910145410 1:84074874-84074896 TCTAATATTTTATTATTGTATGG - Intergenic
912024306 1:105147890-105147912 TCTAATGTTTAATGGGCGTAAGG + Intergenic
912199836 1:107444239-107444261 CCTGATGTTTTAGAGGTCTATGG - Intronic
914457731 1:147852102-147852124 TTTATTGTTTTATACCTGTATGG - Intergenic
915611753 1:156999289-156999311 TCTACTATTTAATAGCTGTATGG - Intronic
916150663 1:161785902-161785924 TCATATGTTTTATATGTTTAAGG + Intronic
917388464 1:174504531-174504553 TCTTCTGTTTTATTGGTCTATGG - Intronic
918668052 1:187177320-187177342 TCTGATGGTTTAAAAGTGTATGG - Intergenic
919114770 1:193267084-193267106 TAAAAAGTTTTATAGGTTTATGG + Intergenic
919256389 1:195129769-195129791 TCTGAGGTTTTATACGTGTTTGG - Intergenic
920282004 1:204850604-204850626 TCTGATGGTTTAAAAGTGTATGG + Intronic
920785123 1:209033943-209033965 TCTTATCTTTTAAAGGTGTGTGG - Intergenic
921225240 1:213012987-213013009 CCTAAGGTTTTAGAGGTGTTTGG - Intronic
921305376 1:213791380-213791402 ACTAATGTTTTGTTGGTGTCTGG - Intergenic
921883279 1:220277470-220277492 TCTATTTTTTTAGAGGTGGATGG + Intergenic
922569848 1:226628015-226628037 TCTGATGTTTTAAAAGTGTTTGG - Intergenic
1065765865 10:29028848-29028870 TCTGATGGTTTAAAGGTGTGTGG - Intergenic
1066125834 10:32341937-32341959 TCTAACATTTTATAGGCATATGG + Intronic
1067259683 10:44678399-44678421 TTTAATTTTTTATAGATTTAGGG + Intergenic
1068210994 10:53920262-53920284 TCTAATGTTTTATAGGTGTATGG - Intronic
1068929109 10:62570474-62570496 TTTAATTTTTTTTAGTTGTAAGG - Intronic
1071022702 10:81077518-81077540 TCTAAGGTTTTATAGTTTTAGGG + Intergenic
1073064271 10:100749093-100749115 TCTAATGTTATTTATCTGTAGGG - Intronic
1074632320 10:115272398-115272420 ACTGATGATTTAGAGGTGTAAGG + Intronic
1075196452 10:120363657-120363679 TTTAATGTTTTATAGATTCAGGG - Intergenic
1079514468 11:21250788-21250810 TATAATGTTTGATAGGTACATGG + Intronic
1080152458 11:29069421-29069443 TCTCATTTTTTATAGCTGCATGG - Intergenic
1080448691 11:32360853-32360875 TGTAATGTTTTATACATTTACGG + Intergenic
1080623014 11:34003203-34003225 TCTGATGTTTTATAAATGTTTGG + Intergenic
1080897307 11:36457300-36457322 GATAATGTTTTATAAGAGTATGG - Intronic
1081016861 11:37892625-37892647 TCTTATGTTTTAAAAGTGTGTGG + Intergenic
1081043089 11:38235820-38235842 TCTAATAGTTTAAAAGTGTATGG + Intergenic
1085806887 11:79644649-79644671 TCTAATGATTTAAAAGTGTGTGG - Intergenic
1086018018 11:82191173-82191195 TCTAATATTGTATGGGTGGAGGG - Intergenic
1086862335 11:91939595-91939617 TCTAATGGTTTAGAAGTGTTTGG + Intergenic
1086926853 11:92650051-92650073 TCTAATGTTTTATAACTCTTAGG - Intronic
1088378375 11:109166773-109166795 GCTAATGCATTTTAGGTGTAGGG + Intergenic
1088393149 11:109338016-109338038 TATAATGTTTTATATATATATGG - Intergenic
1089314664 11:117583359-117583381 GCTAGTGTTCTATAGGTGAAGGG - Intronic
1090173024 11:124621892-124621914 TGAAATGTTTTGTAAGTGTAAGG + Intergenic
1090260880 11:125318851-125318873 TCTGATGGTTTATAAGTGTCTGG + Intronic
1090849293 11:130557887-130557909 TCTTATGCTTTATAGGTATTTGG - Intergenic
1092584554 12:9884368-9884390 TATAATATATTACAGGTGTAAGG + Intronic
1093263456 12:16969998-16970020 TCTGATGGTTTATAAGTGTTTGG + Intergenic
1093920869 12:24857772-24857794 CCTAATGTTTTTTACTTGTAGGG + Intronic
1094810377 12:34131352-34131374 ACTAATGTTTTATAGTTTTGAGG + Intergenic
1096886749 12:54726204-54726226 TCTGATGGTTTAAAAGTGTATGG - Intergenic
1097736294 12:63184942-63184964 TCAGATGGTTTATAGGTGTGTGG + Intergenic
1098871279 12:75819898-75819920 TTTCATGTTTTATTTGTGTATGG - Intergenic
1099068266 12:78011920-78011942 TCTGATGCTTTAAAAGTGTATGG - Intronic
1101056491 12:100921589-100921611 TTAAATGTTCTATAGGTGTATGG + Intronic
1102424832 12:112835054-112835076 TCTAATTTTATATTGGTGAAGGG + Intronic
1107541914 13:41396713-41396735 TCTGATGGTTTAAAAGTGTATGG - Intergenic
1109422203 13:62128609-62128631 TTTATTTTTTTATAGATGTAGGG + Intergenic
1109898944 13:68737138-68737160 TCCAATATTTTCTAGGTGGAAGG + Intergenic
1110328314 13:74242691-74242713 TCAATTGTTTAGTAGGTGTAGGG + Intergenic
1110550891 13:76810240-76810262 TCTAATGGTTTAAAAGTGTGTGG + Intergenic
1110989144 13:82014963-82014985 TTTTGTGTTTTATAGGTTTACGG - Intergenic
1111319881 13:86613472-86613494 TTTCATTTTTTATTGGTGTAGGG + Intergenic
1111425546 13:88075885-88075907 TCTAACGTTATATAGCAGTATGG - Intergenic
1111639764 13:90953024-90953046 TCTAATGAGTTCTAGGTGTTGGG - Intergenic
1111913319 13:94335693-94335715 TCTGTTGTTTTATATGTGTGTGG + Intronic
1113242843 13:108359045-108359067 TTTAACCTTTTGTAGGTGTAGGG + Intergenic
1117853731 14:60005400-60005422 TCTTCTGTTTAATAGGTTTATGG - Intronic
1118396321 14:65340173-65340195 TCTGATGTTTTAAAAGTGTGTGG - Intergenic
1120101687 14:80451623-80451645 TCTAATGGTTTAAAAGTGTGTGG + Intergenic
1121860766 14:97315937-97315959 TCTCATGGTTTAAAGGTGTGTGG - Intergenic
1124089558 15:26585423-26585445 TCTAGTGTTTTACAGGTGTTTGG - Intronic
1126197538 15:45949039-45949061 TCTGATGGTTTAAAAGTGTAGGG + Intergenic
1126418677 15:48447332-48447354 TCTATGTTTTTATGGGTGTAGGG - Intronic
1131209054 15:90477650-90477672 TCTGATGTTTTATAGGTCGAAGG + Exonic
1132640945 16:978313-978335 TGTAATGTGTGATATGTGTATGG - Intronic
1133045330 16:3085208-3085230 TCTAATGTTTTAAAAGTGTTTGG - Intergenic
1133686254 16:8168119-8168141 TTTAAAGTTTCATAGGTGTGAGG - Intergenic
1134802062 16:17093797-17093819 TTTAATGTTTTATAGAGGCATGG + Intergenic
1142309005 16:89301293-89301315 TCTACTTTTTTATATGTGTAAGG - Intronic
1143938356 17:10511134-10511156 TCTAAACTTTTATCTGTGTACGG - Intronic
1144030134 17:11312616-11312638 TATATTGTTTTATATGTGTTTGG - Intronic
1144141874 17:12357312-12357334 TTTAAAGTTTTATAGATTTAGGG + Intergenic
1146798090 17:35796921-35796943 TTTAATGTTTTATAGAAGAAGGG + Intronic
1150887943 17:69109352-69109374 TGTAATGTTTTCTACGTGTTAGG - Intronic
1153132625 18:1874159-1874181 TCTAATAGATTATAGATGTAAGG + Intergenic
1153332982 18:3892921-3892943 TATAATTTTTTATAGGTTTAGGG + Intronic
1155646279 18:28082076-28082098 TCTAATATTTTCTTGTTGTAAGG + Intronic
1156621090 18:38852902-38852924 TCTTATGTTATCTAGGTGAATGG - Intergenic
1157250368 18:46090048-46090070 TCTTATGTAGTATTGGTGTATGG - Intronic
1157929008 18:51799579-51799601 TTTAATGTTTTATTGTTTTATGG + Intergenic
1158973991 18:62694037-62694059 TCTGATTTTTTATTGGTGTATGG + Intergenic
1162929415 19:13949679-13949701 TCTAATGTTTTTTGGGTTTTGGG + Intronic
1164278639 19:23748158-23748180 TCTAATGTTTTTTTGATGTGTGG - Intronic
924996926 2:370018-370040 ACTAATGTTTTATAGTTTTTAGG + Intergenic
925233129 2:2253477-2253499 TCTAATGCTCTATAGGGGGAAGG + Intronic
925765526 2:7231318-7231340 TATAATATTTTAAATGTGTAAGG - Intergenic
928192849 2:29189332-29189354 TCAAATGTTTTACAGTTGTTAGG + Intronic
930452566 2:51560618-51560640 TCTAATGGTTTAGAAGTGTGTGG - Intergenic
931109982 2:59099765-59099787 TCTGATGGTTTAAAAGTGTATGG - Intergenic
931669587 2:64635206-64635228 TGTAATGTTTTATATGTGTATGG - Exonic
933563549 2:83920247-83920269 TCTAATGTTTCAGAAGGGTAGGG + Intergenic
936859551 2:117001107-117001129 TTTAATTTTTTATAGATTTAGGG - Intergenic
937547735 2:123044528-123044550 TCAAATGTTTTATAACTGTAGGG - Intergenic
937688609 2:124726369-124726391 TCTAATGGTTTAAAAGTGTTTGG + Intronic
939361377 2:141176420-141176442 TCTAATGGTTTAAAAGTGTGTGG + Intronic
941945761 2:171095199-171095221 TCTAGTGTTTTTTGGGTGGACGG - Intronic
943196288 2:184754915-184754937 TCTGATGGTTTAAAGGTGTGTGG - Intronic
943418896 2:187641861-187641883 TATAATGTTTTCTTGGTGCAAGG - Intergenic
943713082 2:191119794-191119816 TATAATGTGGTATAGGTGCAGGG + Intronic
943995402 2:194758808-194758830 TATAATGTTTTATAAAAGTATGG + Intergenic
944357585 2:198810234-198810256 TCTAATGTTTAATAGATTGATGG + Intergenic
945607395 2:211952050-211952072 TCTAATCTTTTATATGTAGAGGG + Intronic
947067624 2:226247179-226247201 TGTAATCTTTTATGAGTGTAAGG + Intergenic
947350416 2:229238104-229238126 TATAATGTTTTAAAGAAGTAAGG - Intronic
1170549325 20:17462746-17462768 TCAAATGTTTTATATGAGTCGGG - Intronic
1171155922 20:22873921-22873943 TCTCATGTTTTGTAGTTGTATGG - Intergenic
1173107402 20:40150931-40150953 TCTACTATTTTATATGTGTGGGG + Intergenic
1176452978 21:6880632-6880654 CCTAATGTTATCTATGTGTAAGG + Intergenic
1176511229 21:7750051-7750073 TCTAATGTTTCACAGGGGTCAGG - Intronic
1176831151 21:13745680-13745702 CCTAATGTTATCTATGTGTAAGG + Intergenic
1176960643 21:15155057-15155079 TCTGATGGTTTATAAGTGTCTGG - Intergenic
1177883803 21:26724396-26724418 TCTTATGCTTTAAAGGTGTTTGG + Intergenic
1178296554 21:31415065-31415087 GCTTTAGTTTTATAGGTGTAAGG - Intronic
1178645343 21:34380580-34380602 TCTAATGTTTCACAGGGGTCAGG - Intronic
1179562868 21:42227868-42227890 TCTAATGTTCTAAATGTGTGTGG - Intronic
949973538 3:9433282-9433304 TCTAATATTTGAAAGGTGTTGGG + Intronic
951033001 3:17903703-17903725 TCCAATTGTTTATATGTGTAAGG - Intronic
951081412 3:18454466-18454488 TCTGATGGTTTAAAAGTGTATGG - Intergenic
951427820 3:22568746-22568768 TCCAATGTTATATAGGTGGAAGG - Intergenic
951490203 3:23261860-23261882 TTTATTCATTTATAGGTGTATGG + Intronic
951830704 3:26923581-26923603 TCTAAATTTGTATAAGTGTAAGG + Intergenic
952386835 3:32847832-32847854 TGTAATGTTTTATATATTTATGG + Intronic
952448398 3:33406431-33406453 TGTTATGTTTTATATGTGCAGGG - Intronic
952785720 3:37152957-37152979 TCTAATGATTTTTATGTGTCTGG - Intronic
952805516 3:37346377-37346399 TTTAATGTTTTATATGTTTTGGG + Intronic
954434518 3:50489112-50489134 TCCTATGTTTCATAGTTGTAAGG - Intronic
956494067 3:69805594-69805616 TCTAATATTTAATATGTGCATGG + Intronic
956591289 3:70917724-70917746 CCTCATGTTTTATAAGAGTAGGG - Intergenic
956654995 3:71540871-71540893 TCTAATCTTTCATTGGTGTTTGG - Intronic
957566075 3:81885790-81885812 TCTAACATTTTCTAGCTGTATGG + Intergenic
957789991 3:84928483-84928505 TCTAATGGTTTAAAAGTGTGTGG - Intergenic
958836993 3:99157515-99157537 TCTAATGGTTTAAAAGTGTGTGG + Intergenic
958977089 3:100681012-100681034 TTTAATTTTTTAAAGGTTTATGG - Intronic
959767204 3:110046004-110046026 TCTAATATTCTAGAGTTGTAGGG + Intergenic
960900856 3:122553079-122553101 TCTAATGTTTTTATGGTTTAAGG + Intronic
961067457 3:123888713-123888735 TCTGATGGTTTAAAAGTGTATGG - Intergenic
963506955 3:146198404-146198426 TGTAATTTTTTTTAGGAGTAAGG + Intronic
965004011 3:162993666-162993688 TCTGATGGTTTAAAAGTGTATGG + Intergenic
965224345 3:165969505-165969527 TGTAATGTTATATATGTGAAAGG - Intergenic
965389210 3:168084138-168084160 ACTGATGGTTTAAAGGTGTATGG + Intronic
966709334 3:182954667-182954689 ACTAATGTTTAACAAGTGTATGG - Intronic
967567532 3:190989368-190989390 TCTGATGGTTTAAAAGTGTATGG + Intergenic
967728898 3:192888523-192888545 TCTAATGTTTTATGGTTGTCAGG + Intronic
969195521 4:5560481-5560503 TCTGATGTTTTATAAGTATCTGG - Intronic
970769227 4:19590608-19590630 TCTAATGGTTTAAAGGTGTGTGG - Intergenic
971150464 4:24026024-24026046 TCAAAGGTTTTAAAGATGTAGGG - Intergenic
971855805 4:32042094-32042116 TCTAATGTTTTATAGTGGAAAGG - Intergenic
972014902 4:34231628-34231650 TCTGATGGTTTAGAAGTGTATGG + Intergenic
972107873 4:35514194-35514216 TCTAATAGTTTAAAAGTGTATGG + Intergenic
972447089 4:39154653-39154675 TGTGATTTTTAATAGGTGTACGG + Intergenic
972980276 4:44690487-44690509 TATAATGTTTTATAAGTGTCAGG + Intronic
973609557 4:52622228-52622250 TCCATTTTTTTATAGGTGTTGGG + Intronic
974311160 4:60211121-60211143 TCTAATGGTTTAAAAGTGTGTGG - Intergenic
974910600 4:68114388-68114410 TTTTATGTTTAATAGGTCTATGG - Intronic
975484747 4:74923362-74923384 TTTAATGTTTTATAGGGATGGGG - Intergenic
975803021 4:78082025-78082047 TATAATATTTTAAATGTGTAAGG - Intronic
976450646 4:85186821-85186843 TCTGATGGTTTAAAAGTGTATGG - Intergenic
977453702 4:97230295-97230317 TCTACTATATTAGAGGTGTAAGG + Intronic
977774068 4:100896364-100896386 TCTACTGTTCTTTAGGAGTATGG - Intergenic
978554622 4:109966057-109966079 TTTAAATTTTTATAGGTTTAGGG + Intronic
978615436 4:110589052-110589074 TCTAATTTTTCTTAGGTATATGG + Intergenic
978751224 4:112249673-112249695 TATAATTTTTTATAGATTTAGGG + Intronic
978942618 4:114455216-114455238 TCTAGTGTTTCCTAGGTGCAAGG - Intergenic
979214035 4:118140926-118140948 TCTAATTTTTTAGAGGTCTCTGG - Intronic
979793803 4:124818770-124818792 TCTATTGGTTTAAAAGTGTATGG + Intergenic
980291397 4:130850682-130850704 TATAATGCTTTATTGGTGTAAGG + Intergenic
982917367 4:161228571-161228593 TCTGATGTTTTAAAAGTGTGTGG - Intergenic
982981664 4:162145186-162145208 TCTCATATTTTATATGTTTATGG - Intronic
983380358 4:166983550-166983572 TCTAGTGTTCTATAGCTGCATGG + Intronic
983518558 4:168681954-168681976 TCTAATTTATTATAAATGTATGG + Intronic
983561775 4:169108838-169108860 TCTAAGCTTTAGTAGGTGTAGGG - Intronic
984394663 4:179180597-179180619 TATAATGTGTTATAACTGTAAGG - Intergenic
984429708 4:179633022-179633044 ATTAATGTTTTATAGGTTTCAGG + Intergenic
984489759 4:180418110-180418132 TTTAATGTTTTATAATTTTAAGG - Intergenic
984810418 4:183791544-183791566 TCTAATGTTTCATATATCTATGG + Intergenic
985196401 4:187434830-187434852 CACAATGTTTTATAGTTGTAAGG - Intergenic
985477615 5:87769-87791 GTTAATTTTTTACAGGTGTAAGG + Intergenic
987453689 5:18117701-18117723 ATAAATGTTTTAAAGGTGTAGGG + Intergenic
987597611 5:20021231-20021253 TTTACTGTCTCATAGGTGTAAGG + Intronic
987630380 5:20462416-20462438 TCTAATGTTTGATAGCTGAGTGG + Intronic
988501166 5:31784934-31784956 TCTAATGTTTTCTAGTAGTGGGG + Intronic
989996542 5:50839814-50839836 TCTAATGCTTTTTAAGTGTCAGG + Intronic
990107690 5:52284860-52284882 TCTCATGTGCTAAAGGTGTAGGG + Intergenic
991226594 5:64280422-64280444 TCTAGGGTTTTATAGTTTTATGG + Intronic
991420199 5:66432988-66433010 TCTGATGATTTATAAGTGTGGGG - Intergenic
992988285 5:82256467-82256489 TCTAATGTTTAATAACTGTCAGG - Intronic
993237029 5:85324513-85324535 TCTTATGGTTTAGAGGTCTACGG - Intergenic
994425077 5:99575407-99575429 TCTGATGGTTTAAAAGTGTATGG + Intergenic
994436262 5:99736838-99736860 TCTGATGGTTTAAAAGTGTATGG - Intergenic
994783830 5:104129437-104129459 TCTAATTGTTTATGGGAGTAGGG + Intergenic
996627572 5:125588181-125588203 TCTACTGGTTTAGAGGTGTTAGG - Intergenic
997635629 5:135402745-135402767 TCTATTGTTTTATAGAAGAAGGG + Intergenic
998010044 5:138687675-138687697 TCTTATTTTTTATAGAGGTAGGG + Intronic
998708977 5:144799334-144799356 TCTAATATATGATATGTGTAAGG - Intergenic
998800293 5:145862319-145862341 TCTAATGTCATATAGTTCTAGGG + Intronic
998807369 5:145931855-145931877 TCTAAAGTTTTAGAGCTGCAGGG - Intergenic
999032328 5:148307540-148307562 TCTGATGGTTTAAAAGTGTATGG - Intergenic
999067222 5:148701110-148701132 TCTGATGTTTTATATTTTTAGGG - Intergenic
1001212080 5:169819446-169819468 TTTAATTTTTTGTAGGTGTAGGG - Intronic
1002436821 5:179236624-179236646 GCTAATTTTTTTTATGTGTATGG - Intronic
1004439668 6:15636929-15636951 TTAAGTGTTTTATAGCTGTAGGG + Intronic
1005187068 6:23174540-23174562 TCTAATGGTTTAAAAGTGTGTGG - Intergenic
1006766920 6:36514470-36514492 TCTAGAGTTTTAGAGGTGAACGG + Intronic
1007132483 6:39488743-39488765 TCTAATGTTTAGTTGGTGAATGG - Intronic
1008105273 6:47434220-47434242 TTTCATGTTTTATATGTGTGAGG - Intergenic
1009307691 6:62111707-62111729 TCTAATTTTTTGTAGATATAGGG - Intronic
1009743612 6:67782720-67782742 TCTAGTGCTTTAGAGGTGAAAGG - Intergenic
1010878175 6:81135535-81135557 TGGAAGGTTTTACAGGTGTAAGG - Intergenic
1012170208 6:96007747-96007769 TCTAATTTTTTATAGGACTAGGG + Intergenic
1012191013 6:96279920-96279942 TCTGATGTTTTAAAAGTGTACGG + Intergenic
1012572733 6:100750721-100750743 TCTAATGTTTTATAAAAGAATGG - Intronic
1012589655 6:100965266-100965288 GCTAATTTTTAATAGGTTTAAGG + Intergenic
1012762085 6:103315432-103315454 TTTAATTTTTATTAGGTGTAAGG + Intergenic
1012973227 6:105753597-105753619 TTTATTGTTTTATTGGTGGATGG + Intergenic
1013028546 6:106306264-106306286 GCTTATATTTTATAGGTTTATGG - Intronic
1013081864 6:106820341-106820363 TTTAATGTTTTATAGGGGCTTGG - Intergenic
1013874780 6:114811936-114811958 TCTAATGGTTTAAAAGTGTGTGG + Intergenic
1014297683 6:119640599-119640621 TCTGATGGTTTAAAAGTGTATGG - Intergenic
1014338448 6:120170533-120170555 TCTAATGTTTTCTATTTGCAAGG - Intergenic
1016282602 6:142435518-142435540 TCTAATGTGTTAAATGTGTTTGG - Intronic
1021291549 7:18851352-18851374 TCTAATGGTTTAAAAGTGTTTGG + Intronic
1022292205 7:29015484-29015506 TCTAAAGGTTTAAAGGTGTGTGG + Intronic
1023500963 7:40848880-40848902 TTTAATGTGTTCTAAGTGTATGG + Intronic
1025748157 7:64264982-64265004 TCTAATTTTATTTAGGTGTCTGG + Intronic
1025784789 7:64634444-64634466 TCTAATTTTTTCTTTGTGTAGGG - Intergenic
1027975219 7:85145328-85145350 TTTAATGTTTTATTGGTTTGGGG + Intronic
1030343786 7:108410334-108410356 TGTAATGTTTTAAAGGTTTGTGG - Intronic
1031648842 7:124260497-124260519 TCTGATGTTTTGTAAGTGTCTGG + Intergenic
1032372253 7:131368576-131368598 TCTGATGTTTTAAAAGTGTGTGG - Intronic
1032423458 7:131801662-131801684 TCTGATGATTTAAAAGTGTATGG + Intergenic
1032805465 7:135349788-135349810 TCTAATGTTTTGTAGAGGTGAGG + Intergenic
1033019047 7:137703232-137703254 TCTGATGGTTTAAAAGTGTATGG - Intronic
1034511113 7:151535520-151535542 TCTGATGGTTTAAAGGTGTTTGG + Intergenic
1036562630 8:9909755-9909777 TCTACTCTTTTATAGTAGTAAGG - Intergenic
1038300780 8:26345305-26345327 TGAAATGTTTTATATGTGTGAGG - Intronic
1038364518 8:26917365-26917387 ACTAATGTTTTACAGTTTTAAGG - Intergenic
1039463519 8:37765334-37765356 TCAAATGTTTTTTAGGCGCATGG - Intronic
1040091151 8:43400337-43400359 TCTAATGGTTTAAAAGTGTATGG - Intergenic
1040799090 8:51321585-51321607 TCTGATGGTTTAAAGGTGTGTGG + Intronic
1041352041 8:56956931-56956953 TCTTAAGTTTTGTAGGTGTTAGG - Intergenic
1041694714 8:60723772-60723794 TGTACTGTTTTAAAGTTGTAAGG + Intronic
1042424498 8:68631748-68631770 TCTGATGGTTTAGAGGTGTTCGG + Intronic
1043102321 8:76061150-76061172 TCTAATGGTTTAAATGTGTTTGG + Intergenic
1046376631 8:113390870-113390892 TCTAAGGTTTTCAAGATGTAGGG - Intronic
1046781811 8:118223455-118223477 TCTAATGTTCTGTAGGAGTATGG + Intronic
1047473697 8:125204565-125204587 TCTTATATTTGATAGTTGTATGG + Intronic
1048605817 8:135967748-135967770 TCTAATGTTTAATAGATCAATGG - Intergenic
1049946740 9:604424-604446 TCTAATGGTTTAAAAGTGTTTGG + Intronic
1050054717 9:1639822-1639844 TAAAATGATTTTTAGGTGTATGG + Intergenic
1051870700 9:21734710-21734732 TTTAATCTTTTTTAGGTGAAAGG + Intergenic
1052644298 9:31212917-31212939 TCTATTGGTTTATAAGTTTATGG + Intergenic
1056392190 9:86150643-86150665 TCCAATGGTTCAAAGGTGTATGG + Intergenic
1058102822 9:100936134-100936156 TCTGATGGTTTATAAGTGTGTGG + Intergenic
1058347868 9:103985897-103985919 TTTAAGGTTTTCTAGGTATAAGG - Intergenic
1059025283 9:110621339-110621361 TCTAATTTTTTCTAAATGTATGG - Intergenic
1060745495 9:126128191-126128213 TCTAATGGTTTAAAAGTGTTTGG + Intergenic
1061036332 9:128116274-128116296 TGTAATGTTTTGTAGATATAGGG - Intergenic
1203516203 Un_GL000213v1:3883-3905 CCTAATGTTATCTATGTGTAAGG - Intergenic
1185988056 X:4857994-4858016 TCTTAAGTTTTACAGGTTTAGGG + Intergenic
1186599124 X:11017737-11017759 TTTAATTTTATGTAGGTGTATGG + Intergenic
1187856414 X:23640354-23640376 TTTAGGGTTTTCTAGGTGTATGG - Intergenic
1188043948 X:25403984-25404006 TCTAAGGTTTTATAGGGGGCTGG - Intergenic
1189686235 X:43566306-43566328 TTTAATGTTATATAGGTTTCTGG + Intergenic
1189824883 X:44907997-44908019 TTTAATTTTTTATTGGGGTAGGG + Intronic
1190167690 X:48086670-48086692 TCTGATGGTTTAAAGGTGTTTGG + Intergenic
1190515417 X:51218901-51218923 TATAATGTTTTCTAGATATAGGG + Intergenic
1190586200 X:51945197-51945219 TCTAATGGTTTAAAAGTGTTTGG + Intergenic
1190632937 X:52406130-52406152 TCTAATGGTTTAAAAGTGTGTGG - Intergenic
1192025964 X:67451979-67452001 TCTAATGTTTGATAGCAGTTGGG + Intergenic
1192992740 X:76478891-76478913 TCTAATGTTTTTTATTTGTCTGG + Intergenic
1193256607 X:79355869-79355891 TCTGATGGTTTAAAGGTGTGTGG + Intergenic
1194352822 X:92841294-92841316 TCTGATGGTTTAAAAGTGTATGG - Intergenic
1194582710 X:95696565-95696587 TCTGATGTTTTATAAGCGTCTGG + Intergenic
1194645477 X:96453834-96453856 ACTAATGTTTTCTGGGTGAATGG - Intergenic
1194935460 X:99942386-99942408 TCTACTGTGTTCTAGGTGTCAGG - Intergenic
1195769565 X:108335860-108335882 TCTAATGCTTAATATGTGTCAGG + Intronic
1196371579 X:114985155-114985177 TCTGATGGTTTAAACGTGTATGG + Intergenic
1196390512 X:115203169-115203191 TCTGATGGTTTATAAGTGTGTGG - Intronic
1196960751 X:120998063-120998085 TTTTATGTTTTATATGTATAAGG + Intergenic
1197636919 X:128925771-128925793 TCTGATGGTTTAAAGGTGTGTGG - Intergenic
1198090982 X:133329647-133329669 TCTTATTTTTTATATGTGTGTGG - Intronic
1200514325 Y:4124580-4124602 TGTAATTTTTTAAAGGTGTCAGG - Intergenic
1200661124 Y:5958036-5958058 TCTGATGGTTTAAAAGTGTATGG - Intergenic
1201367444 Y:13223631-13223653 TTAAATTTTTTATAGGTTTAGGG - Intergenic
1201490241 Y:14533136-14533158 ACTAAGGTTTTATAAATGTAGGG - Intronic