ID: 1068211314

View in Genome Browser
Species Human (GRCh38)
Location 10:53924256-53924278
Sequence GGTGGACTCCGCACTCAGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068211308_1068211314 6 Left 1068211308 10:53924227-53924249 CCAGCGTGAGTTCCGGTGGGCAT 0: 1
1: 0
2: 2
3: 14
4: 44
Right 1068211314 10:53924256-53924278 GGTGGACTCCGCACTCAGAGCGG No data
1068211313_1068211314 -6 Left 1068211313 10:53924239-53924261 CCGGTGGGCATGGGCTTGGTGGA 0: 1
1: 1
2: 11
3: 46
4: 240
Right 1068211314 10:53924256-53924278 GGTGGACTCCGCACTCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068211314 Original CRISPR GGTGGACTCCGCACTCAGAG CGG Intronic
No off target data available for this crispr