ID: 1068211994

View in Genome Browser
Species Human (GRCh38)
Location 10:53932355-53932377
Sequence CTGTGCTTCTATAAGTATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 121}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068211994 Original CRISPR CTGTGCTTCTATAAGTATGC AGG (reversed) Intronic
900887407 1:5424639-5424661 CTCTGCTTCTATAGCTAGGCTGG - Intergenic
905310063 1:37042957-37042979 CTGTGCTTCTCTGAGTGTCCTGG - Intergenic
907912375 1:58837858-58837880 CTTTGCTTCTTTCAGTATGGTGG + Intergenic
911884811 1:103284597-103284619 ATGTGCTTCTATAAGCCAGCTGG + Intergenic
912254533 1:108045582-108045604 CTATGCATCTCTAAGCATGCAGG + Intergenic
919291160 1:195633045-195633067 CTCTGCTTCTATGAGTTTGATGG - Intergenic
1063341972 10:5274517-5274539 ATGGGCTCCTATAAGTATGATGG + Intergenic
1064346178 10:14534585-14534607 CAGTGCTGCTGTAAGCATGCTGG - Intronic
1065325758 10:24549553-24549575 CTGTGCTTCTATCAGGGTCCAGG - Intergenic
1065826567 10:29577627-29577649 TTGTGCTGCTATAAATATGCGGG + Intronic
1066228141 10:33404588-33404610 CTGTCCTTTTATAAGTGAGCTGG + Intergenic
1066441015 10:35438635-35438657 CTGTGGTTCTAAATGTATACAGG - Intronic
1068211994 10:53932355-53932377 CTGTGCTTCTATAAGTATGCAGG - Intronic
1069343612 10:67440738-67440760 CTGCACCTCTATAAGTTTGCAGG + Intronic
1080843286 11:36004470-36004492 CTCTGCTTCTGTGAGTCTGCAGG + Intronic
1082625830 11:55484256-55484278 TTGTGCTGCTATAAACATGCGGG + Intergenic
1084394198 11:68898177-68898199 CTGTGGTTCTAAAAGGATACAGG - Intronic
1086026017 11:82292814-82292836 TTATGCTGCTATAAATATGCAGG - Intergenic
1088685086 11:112278359-112278381 CTGTGCTAATATAAATATGAGGG - Intergenic
1092328148 12:7556073-7556095 CTATGCTTGTATAAGAAAGCAGG + Intergenic
1094777181 12:33744359-33744381 CTCTGCTTCTATACGTTTGATGG - Intergenic
1100165743 12:91915491-91915513 CTCTGCTTTTATAAGTAGCCAGG - Intergenic
1100790349 12:98123455-98123477 CTGTGCTTCTCTAGGAAAGCAGG - Intergenic
1102620660 12:114192062-114192084 CTGTGATTCTATAACTGTGCAGG + Intergenic
1102844317 12:116162319-116162341 CTGTGATTCTATTAGAATGGAGG + Intronic
1103153230 12:118660158-118660180 CTTTGGTTCTGTTAGTATGCTGG + Intergenic
1104077256 12:125400969-125400991 CTGTGCTGCTATAGGTCTGGGGG - Intronic
1112952673 13:105020444-105020466 CTGTGCTTGTATCTTTATGCTGG + Intergenic
1116692919 14:48134217-48134239 CTGTGTTTCTATATATCTGCAGG - Intergenic
1116994384 14:51307164-51307186 CTGTCCTTCTATAGGGATGAAGG - Intergenic
1119335898 14:73833549-73833571 CTGTGTTTTTATAAGTAGGAGGG + Intergenic
1126611266 15:50531983-50532005 CTGTGATTCTCTATGTTTGCTGG - Intronic
1127411398 15:58710833-58710855 CTCTGCTTCTCAAAGTCTGCTGG + Intronic
1136381696 16:29899045-29899067 CTGTGCCTCTCTAAGTAATCTGG + Exonic
1137329668 16:47479872-47479894 CTCTGCTTCTGTCAGTTTGCTGG + Intronic
1143340762 17:6208947-6208969 CTGTGCCTGTTTATGTATGCAGG - Intergenic
1143748328 17:9009985-9010007 CTGTCCTTCTCTAACTCTGCTGG + Intergenic
1144802368 17:17938619-17938641 CTGTGCATTTATGAGTATGTGGG - Intronic
1145865113 17:28236166-28236188 CTTAACTTCTATAAGTATGGGGG + Intergenic
1146397031 17:32476521-32476543 CTGTTCTTATATAAGCATGTAGG + Intronic
1149005239 17:51798224-51798246 CTGAGCTTCTATAAGGAAGGAGG - Intronic
1159358779 18:67372722-67372744 CTGTGCTTCTGTATTTATGCTGG + Intergenic
925521004 2:4745931-4745953 CTGTGTGTGTATAGGTATGCAGG - Intergenic
926854195 2:17234538-17234560 CTGTACTTCTAGAAGTATCTTGG + Intergenic
928913414 2:36445957-36445979 CAATGCTCTTATAAGTATGCTGG - Intronic
930109128 2:47663603-47663625 CTGTGCTTCTGTAAATAAGTAGG + Intergenic
931858818 2:66332423-66332445 CTGTGCTTCTATGTGTTTTCTGG + Intergenic
935803564 2:106724624-106724646 ATGTGCGTCTATGTGTATGCAGG + Intergenic
941381063 2:164792820-164792842 CTGTCCTGCAATCAGTATGCAGG + Intronic
942006392 2:171704265-171704287 CTGTACTTCTTTAACTATCCAGG - Intronic
942878330 2:180829476-180829498 CTGTGGTTCTATAAATGTGGAGG - Intergenic
944528422 2:200643501-200643523 TTGTGCTACTATAAACATGCAGG + Intronic
945928836 2:215833995-215834017 CAGTGTTTATATAAGTATGTTGG + Intergenic
947100689 2:226618166-226618188 CTGTGCTTGTGTGAGTGTGCTGG - Intergenic
947116951 2:226782085-226782107 CTGTGGTTCAAAGAGTATGCTGG + Intronic
947594728 2:231403856-231403878 CTTAACTTCTATAAGTATGGGGG - Intergenic
948077684 2:235178914-235178936 CTGCGGTTCTATTAATATGCTGG + Intergenic
1170464022 20:16606555-16606577 CTGTGGTTATAGAAGAATGCTGG + Intergenic
1170633791 20:18087405-18087427 CAGTGATTCTAGAAGTATTCTGG - Intergenic
1171565890 20:26186565-26186587 CTGTGCTTCAAAAAGAATGTAGG + Intergenic
1173131020 20:40393612-40393634 CTGTGCATTTATATGTAGGCTGG - Intergenic
1173164772 20:40679917-40679939 CTGTGCTCCAATGTGTATGCAGG + Intergenic
1178272505 21:31204769-31204791 ATGTGCTTTTACAAGAATGCAGG - Intronic
1179082328 21:38183146-38183168 CTGTGCTTCTCTGAGTCTTCAGG + Intronic
1182984648 22:34705081-34705103 CTGTGATTCTTTAATTATGGAGG - Intergenic
1185193626 22:49454374-49454396 CTGGGCTTCCATTAGCATGCTGG + Intronic
950596260 3:13985399-13985421 CTGTTCTTCTGTTAGTTTGCTGG + Intronic
953180984 3:40595252-40595274 CTGTGCTTCTCAAAGAATGGGGG + Intergenic
956675682 3:71729939-71729961 GTGTGATACTATAAATATGCAGG + Intronic
959763025 3:109991346-109991368 TTGTGCTGCTATAAACATGCAGG - Intergenic
965239122 3:166171714-166171736 CTGTGCTTCTATGTGTACGCAGG + Intergenic
967149824 3:186638378-186638400 CTGTGCATGTATACATATGCTGG + Intronic
967226150 3:187293303-187293325 CTGTGCTTGTAGAAGTGTCCAGG + Intergenic
967671343 3:192238979-192239001 CTCTGCTTTTATTAGGATGCTGG - Intronic
968081980 3:195852890-195852912 CTGTGCTTCCAAAAGTATGGAGG + Intergenic
972029367 4:34433541-34433563 CTGTGCTTCAAAAAGAATGTAGG + Intergenic
972649173 4:40999730-40999752 CTTTGCTTCTCAAACTATGCAGG - Intronic
979268354 4:118730048-118730070 CTGTGCTTATATCAGCATACTGG - Intronic
979365478 4:119817257-119817279 CTGTGATTCTATGACTATGATGG + Intergenic
980391345 4:132151667-132151689 TTGTGCTGCTATAAATATGCAGG + Intergenic
983383706 4:167029720-167029742 CTGTTCTTCAATAAGGATGTAGG + Intronic
985356875 4:189130311-189130333 CTGTGGCTTTATAAGGATGCAGG + Intergenic
985867726 5:2528509-2528531 TTGAGCTTCTATGAGTATGGGGG - Intergenic
986609271 5:9550703-9550725 CTGTGCTTCTAAATCTAAGCAGG - Intergenic
986924956 5:12735289-12735311 GTGTGTTTCTATATGTGTGCAGG + Intergenic
987337922 5:16913608-16913630 CTGTGTTTCTGTAAGCAGGCAGG - Intronic
992317391 5:75570871-75570893 CTCTGCCTCTGTGAGTATGCAGG + Intronic
993270779 5:85793162-85793184 CTTTGGTTCTATTAATATGCTGG + Intergenic
994039229 5:95238832-95238854 GTGTGCTTGTGTATGTATGCTGG - Intronic
994377497 5:99031532-99031554 CTCTGCACCTATAATTATGCAGG - Intergenic
995767723 5:115637020-115637042 CTGTGATTGTAAAAGTGTGCTGG - Intergenic
996468705 5:123834228-123834250 CTGTACATATATATGTATGCTGG - Intergenic
996646731 5:125826563-125826585 CTGTTCTTCTATGAGGAGGCAGG + Intergenic
1003142751 6:3485338-3485360 CTAGGATTCCATAAGTATGCAGG + Intergenic
1012727870 6:102839300-102839322 TTGTGCCTCTATAAAGATGCAGG - Intergenic
1012921196 6:105222626-105222648 CTGTACTTCTAATAGTATGGAGG - Intergenic
1015439159 6:133227660-133227682 TATTGCTTCTATAAGTGTGCTGG + Intergenic
1015922075 6:138276293-138276315 CTCTGCATCTATTAGTATGCTGG - Intronic
1018818879 6:167357686-167357708 CTGAGCTTCTATAATTCTGGAGG + Intronic
1020018910 7:4850290-4850312 CTGTGCTTATATTATTCTGCAGG - Intronic
1020323325 7:6956076-6956098 CTTAACTTCTATAAGTATGGGGG + Intergenic
1025271583 7:57525339-57525361 CTGTGCTTCAAAAAGAATGTAGG - Intergenic
1025784267 7:64630182-64630204 CTGTGCCTGTATTAGTTTGCTGG - Intergenic
1027584328 7:80039012-80039034 CTGTGCTTTTAAAAGTGTTCAGG + Intergenic
1028661193 7:93277566-93277588 CTGAGCTACAATAAGTATCCTGG + Intronic
1032342117 7:131083700-131083722 CTGTGTATCTATTAGTATGGGGG - Intergenic
1032564872 7:132930954-132930976 TTGTGCTTCTATCTATATGCAGG + Intronic
1041548776 8:59077328-59077350 CCTTTCTTCTCTAAGTATGCAGG + Intronic
1043481320 8:80655695-80655717 GTGCCCTTCTGTAAGTATGCAGG + Intronic
1044560487 8:93607089-93607111 ATGACCTTGTATAAGTATGCTGG - Intergenic
1045445566 8:102259704-102259726 CTGTGCTACAATAATTGTGCAGG - Intronic
1052398942 9:27976329-27976351 CTGTGTTTTAATAAGCATGCAGG + Intronic
1055345856 9:75338024-75338046 TTGTGCTGCTATAAACATGCGGG + Intergenic
1055774807 9:79755720-79755742 CTGTGCTTTTAGGAGAATGCAGG - Intergenic
1057576731 9:96248290-96248312 TTGTTTTTCTATAAGCATGCTGG - Intronic
1058544343 9:106044026-106044048 CTCTGCTTCTAGTAGTATGGAGG - Intergenic
1062228910 9:135470212-135470234 CTGTTCTTCCATAAAGATGCAGG + Intergenic
1187449482 X:19384033-19384055 CTGTGCTTCAACAAACATGCGGG - Intronic
1189038221 X:37514945-37514967 CTGTGGTTTTATAAATATGAGGG - Intronic
1191110520 X:56800234-56800256 CTGTGCTTCTATATGTTCTCAGG + Intergenic
1193181683 X:78465906-78465928 TTGTGCTGCTATAAATCTGCAGG + Intergenic
1193517742 X:82490501-82490523 TTGTGCTGCTATAAACATGCAGG - Intergenic
1193877744 X:86883289-86883311 CAGTACTTCTATGAGTCTGCAGG - Intergenic
1193881115 X:86922241-86922263 CTGTGCTTCTATTGCAATGCTGG + Intergenic
1194347334 X:92782520-92782542 TTGTGCTGCTATAAACATGCGGG - Intergenic
1194898348 X:99473547-99473569 CTGGGCATCTGCAAGTATGCTGG - Intergenic
1196249985 X:113449170-113449192 CTTTGCTTCTCTTTGTATGCTGG - Intergenic
1198230224 X:134682281-134682303 CTGTGCTTCTATAATTAAACCGG + Intronic
1200655658 Y:5899152-5899174 TTGTGCTGCTATAAACATGCGGG - Intergenic
1200836489 Y:7737327-7737349 CTCTGCTTCTACTAGAATGCTGG - Intergenic