ID: 1068213706

View in Genome Browser
Species Human (GRCh38)
Location 10:53955010-53955032
Sequence CCTCAGTTGTTGAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1068213706_1068213711 6 Left 1068213706 10:53955010-53955032 CCCTTTTTCCTCAACAACTGAGG 0: 1
1: 0
2: 2
3: 22
4: 194
Right 1068213711 10:53955039-53955061 TAGGACACAGTTGCCTAGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068213706 Original CRISPR CCTCAGTTGTTGAGGAAAAA GGG (reversed) Intronic
904679753 1:32221166-32221188 CCACACTGGTTGAGGAGAAAGGG + Exonic
905539306 1:38747358-38747380 ACTCAGCTGTCGAAGAAAAACGG + Intergenic
907532944 1:55120101-55120123 GCTCACTTGTTGAGGTAAGATGG + Intronic
908755491 1:67465667-67465689 CCTGAGTTGATGATGAAAACAGG + Intergenic
911035663 1:93543404-93543426 CCTCAGTTGTTACTGAAAGAAGG - Intronic
911817835 1:102376253-102376275 CCTCTGTTGTTGAATAAAATAGG + Intergenic
913270661 1:117090033-117090055 CCTTTTTTGTTGAGGAAGAAGGG - Exonic
913297966 1:117340106-117340128 CCTCTGTTCTTGAGGGAAAATGG + Intergenic
913435003 1:118837995-118838017 CCTCAGTGGAAGAAGAAAAAAGG + Intergenic
915168410 1:153961674-153961696 CCTCAGTTTTAGAGGAAAAAAGG + Intronic
915894446 1:159800662-159800684 ACTCAGTTGTTTAGGAAAGAGGG - Intronic
917315642 1:173722263-173722285 CTTAAATGGTTGAGGAAAAAAGG + Intronic
917327858 1:173851537-173851559 CTGCTGTTCTTGAGGAAAAAGGG - Intronic
917493121 1:175515366-175515388 CCTCAGATGCTAAGGAAACATGG + Intronic
918817026 1:189200010-189200032 CCTCAGCTGTTGCTAAAAAAGGG - Intergenic
919100786 1:193094860-193094882 CATCAGAGGTGGAGGAAAAATGG - Intergenic
919307951 1:195868251-195868273 CCTCATCTGTTGGGGAAGAAAGG - Intergenic
920551239 1:206863060-206863082 CCAGAGTTGTTCAGGAATAAAGG + Intergenic
923278321 1:232417624-232417646 TCTCAGTTGCTTAGGAAGAAAGG + Intronic
1067154369 10:43764317-43764339 TTACAGTTGTTGATGAAAAAAGG - Intergenic
1068151580 10:53139269-53139291 TCTCAGATCTTGAGGAAAACTGG + Intergenic
1068213706 10:53955010-53955032 CCTCAGTTGTTGAGGAAAAAGGG - Intronic
1068381146 10:56255184-56255206 CCTCACCTGGTGAGGAAGAATGG + Intergenic
1070690837 10:78523806-78523828 CATCATTTGTGGAGGAAAAAAGG + Intergenic
1071266187 10:83966976-83966998 CCTCAGTTTTTCAGGACATAAGG - Intergenic
1073044920 10:100631442-100631464 ACTTAGCTGTTGAGGAAAGAGGG + Intergenic
1074154843 10:110789013-110789035 CCTCACTTGTGGAGGAAAATGGG - Intronic
1075084339 10:119404595-119404617 CCTCAGTTTTTGAAGGGAAAGGG + Intronic
1076404781 10:130204535-130204557 CCTCAGCTGTTGACAAAGAAAGG - Intergenic
1077867949 11:6238858-6238880 GCTCAGTTGCTGTGGAAAGAGGG + Intronic
1078638770 11:13076505-13076527 CCTCAGTCTTGGAGGACAAAGGG + Intergenic
1079889647 11:26034946-26034968 CCTCAGTTATGGAAGAGAAATGG - Intergenic
1079975309 11:27083740-27083762 CTTCTCTTGTTGGGGAAAAAGGG - Intronic
1080151052 11:29052371-29052393 CCTCATATGAAGAGGAAAAATGG + Intergenic
1083689194 11:64396515-64396537 CCTCAGTTGGGGAGGAATCATGG - Intergenic
1088738777 11:112749881-112749903 CCACAGCAGTTAAGGAAAAAGGG + Intergenic
1092662873 12:10757685-10757707 TCTCATTTGTAGAGTAAAAATGG - Intergenic
1094237052 12:28180385-28180407 ACTGTGTTTTTGAGGAAAAAAGG - Intronic
1096837059 12:54357771-54357793 GCTCAGTTGCTGAGGAATAGGGG - Intergenic
1096980942 12:55728103-55728125 CCTCAGGTGTCCAGGAAAACTGG + Intronic
1097243900 12:57595251-57595273 CCTCAGTTGCTGGGGAGAAAGGG - Intronic
1097319760 12:58211972-58211994 ACTCAGTGTTTGAGGAAAAGCGG + Intergenic
1097813015 12:64038738-64038760 TTTCAGCAGTTGAGGAAAAATGG + Intronic
1098244162 12:68499174-68499196 CTTCAGTTATTGATGAAAATAGG + Intergenic
1098861622 12:75717206-75717228 CCTCAATTATTGAATAAAAATGG + Intergenic
1099259444 12:80359245-80359267 CCTCTGTTGTAGAGGAGAAGGGG + Intronic
1099998077 12:89801457-89801479 CCACATTTGTGGAAGAAAAAAGG - Intergenic
1101041588 12:100761182-100761204 CCTCAGTGGTGGAGGAAGGAAGG + Intronic
1101410650 12:104465148-104465170 CCTCAGTAAGTGATGAAAAATGG + Intronic
1102632993 12:114298597-114298619 CCCCAGTAGTTGGTGAAAAAGGG - Intergenic
1106780853 13:33057567-33057589 CCCAAGCTGATGAGGAAAAAAGG - Intronic
1108033877 13:46266644-46266666 CCTCAATTGTTCATGAAAATTGG - Intronic
1110604380 13:77414526-77414548 CCACACTTGGTGAGGAAAAGTGG + Intergenic
1111512499 13:89285416-89285438 CCTCACATTTGGAGGAAAAAGGG + Intergenic
1111754771 13:92379393-92379415 CCTCCATTGTTGGGGCAAAAAGG + Intronic
1112827483 13:103408426-103408448 CCTCACTTGCTGAGAAAACAAGG + Intergenic
1113819536 13:113203473-113203495 CCTCAGCTGTTTAGGGGAAAGGG + Intronic
1113945231 13:114040117-114040139 CCTCAGTTGTGCATGACAAAGGG + Intronic
1113973395 13:114207854-114207876 CCTGAGTTGTAGAGCCAAAATGG - Intergenic
1114253695 14:20983563-20983585 CCCCTGTTGTGGAAGAAAAAAGG + Intergenic
1116337775 14:43679918-43679940 CATCTGTTGTGGGGGAAAAAGGG + Intergenic
1118054578 14:62066377-62066399 CCTCAGTTTTCTTGGAAAAATGG + Intronic
1119493797 14:75061612-75061634 TCAAAGTTGTTGAGGGAAAAGGG - Intronic
1124510846 15:30323318-30323340 CCTCAGTTGCAGGGGAAGAAAGG - Intergenic
1124732042 15:32207213-32207235 CCTCAGTTGCAGGGGAAGAAAGG + Intergenic
1124809449 15:32920393-32920415 CCTTGGTTGTAGAGGAAGAATGG - Intronic
1126510486 15:49466426-49466448 TCTAAGTTGTAGAAGAAAAATGG + Intronic
1130255565 15:82324547-82324569 ACTCTGTTGGTGAGGAAAGAGGG + Intergenic
1130599402 15:85265439-85265461 ACTCTGTTGGTGAGGAAAGAGGG - Intergenic
1130746085 15:86655274-86655296 CTTCAATTGTTGGGGAACAATGG - Intronic
1130930716 15:88425077-88425099 GCTCACTTGCTGAGGACAAAGGG + Intergenic
1131222015 15:90592687-90592709 CCTGAGTTAAAGAGGAAAAAAGG - Intronic
1133644398 16:7750290-7750312 GCTTTCTTGTTGAGGAAAAACGG - Intergenic
1138724581 16:59121697-59121719 GCAAAATTGTTGAGGAAAAAAGG - Intergenic
1139484464 16:67248086-67248108 CCTCAGTTTTGGAGAAAAAGTGG + Intronic
1143225072 17:5294604-5294626 CCTCAGATACTGAGGGAAAACGG + Intronic
1147596719 17:41722758-41722780 CCCCAGCTATTGAGGAACAAAGG + Exonic
1149376971 17:56053838-56053860 CCTTAATTAATGAGGAAAAAAGG + Intergenic
1203165035 17_GL000205v2_random:86379-86401 CCACAGTAGTTTAGGAAAAAAGG + Intergenic
1153567075 18:6429318-6429340 AGCCAGTTGTTGAGGATAAATGG - Intergenic
1153682989 18:7518035-7518057 CTTCAGTTGCTGAGGACAGATGG - Intergenic
1157045273 18:44095181-44095203 TCTCAGATCTTGAGGAAAACCGG - Intergenic
1157776209 18:50398397-50398419 TCTCAGATCTTGAGGAAAACTGG - Intergenic
1157917541 18:51681264-51681286 TCTCAAAGGTTGAGGAAAAAGGG + Intergenic
1159470438 18:68848279-68848301 TCAGAATTGTTGAGGAAAAAGGG - Intronic
925549569 2:5057275-5057297 CCTCAGATTTTGAGGGAGAAGGG + Intergenic
925952717 2:8930166-8930188 TCTCAGATCTTGAGGAAAACTGG - Intronic
929137644 2:38639926-38639948 CTTCAGCAGTTCAGGAAAAAAGG - Intergenic
929516781 2:42610550-42610572 TGGCAGTTGTTGAGGAAAAACGG + Intronic
930581863 2:53221154-53221176 CCTTAGTGGTTAAGGAAAGAAGG - Intergenic
934874854 2:97908175-97908197 CCTCAGGTGTTAAGGAAAATAGG - Intronic
935251714 2:101268001-101268023 CCCCAATAGTTGATGAAAAAAGG - Intronic
937237056 2:120437358-120437380 GCTCAGTAGTTGAGGAGAGAGGG + Intergenic
938527363 2:132146227-132146249 CCTTAGGTGTGGAGGGAAAAGGG + Intergenic
939623169 2:144445705-144445727 CCTCATTTTTTGGGGGAAAATGG + Intronic
940682115 2:156799858-156799880 GCTCTGATTTTGAGGAAAAAGGG + Intergenic
942204934 2:173610768-173610790 CCTCTGATGGTGAGGGAAAAAGG + Intergenic
942291081 2:174471600-174471622 CCACAGTAGTTGAGCAAATAGGG + Intronic
943802162 2:192074300-192074322 CCTCATATGTTGAGGAAAAGGGG + Intronic
946882246 2:224188070-224188092 CCTCAGATGTTTAGGAGAAAGGG + Intergenic
948168341 2:235880184-235880206 ACTTATTTGTTAAGGAAAAAGGG - Intronic
1168733711 20:111268-111290 TCCTAGTTGCTGAGGAAAAAGGG - Intergenic
1170130944 20:13019420-13019442 TCTCATTTGTTTAGGAAAAATGG + Intronic
1173257347 20:41404263-41404285 ACTCACTTGAGGAGGAAAAATGG - Exonic
1176406715 21:6372712-6372734 CCACAGTAGTTTAGGAAAAAAGG - Intergenic
1177862587 21:26471866-26471888 TATCAGATGTTGAGGATAAATGG - Intronic
1181471100 22:23140417-23140439 CCTCTGTAGTTGGGGAAAGATGG - Exonic
1181993212 22:26854089-26854111 CCTCTGGTGGTGAGGAAGAAAGG - Intergenic
1182150849 22:28026167-28026189 CCTCAGGTGTTGAGGGCAGAGGG + Intronic
1182798710 22:33012592-33012614 CCACAGTTGTTGAGCATAGATGG - Intronic
949643534 3:6067150-6067172 TCTCAGATCTTGAGGAAAACCGG - Intergenic
950243982 3:11398117-11398139 TCTCAGTAATTGATGAAAAAAGG + Intronic
954337347 3:49927224-49927246 ACTCAGGTGTTCAGGAACAATGG + Intronic
954567341 3:51609663-51609685 ATTCAGTAGTTGAGAAAAAAAGG - Intronic
954767329 3:52930320-52930342 CTACAGTTGTTAAGGTAAAATGG - Exonic
957445152 3:80307381-80307403 TCTCAGATCTTGAGGAAAACTGG - Intergenic
957445897 3:80312444-80312466 TCTCAGATCTTGAGGAAAACCGG - Intergenic
960739827 3:120820914-120820936 CAACAGTTGTTGAGGCAACAGGG + Intergenic
963492415 3:146018010-146018032 TCTCAGATCTTGAGGAAAACCGG - Intergenic
964606962 3:158570686-158570708 ACTCAGTTGTTGAAGGAAATGGG - Intergenic
966451239 3:180064697-180064719 ACTCAGTTTTTGAGCATAAATGG + Intergenic
967654346 3:192028596-192028618 CCTTATTTATAGAGGAAAAAAGG + Intergenic
968178789 3:196574518-196574540 CCTTATTTGTTGAGGAAACAAGG + Intronic
968980180 4:3843747-3843769 CCTCACTTGTTGAAGAGGAATGG - Intergenic
969277736 4:6148374-6148396 CCTCATTTGCTTAGGAAGAAAGG - Intronic
969582237 4:8072137-8072159 CCTCTGCTGTGGAGGAGAAAGGG - Intronic
970464664 4:16310598-16310620 CCTCATTTGTTGTGGCTAAAAGG - Intergenic
972844625 4:42972520-42972542 CCTGAGTTATCCAGGAAAAAGGG - Intronic
975802858 4:78080352-78080374 GCTCAGGTGTTCAGGAGAAACGG + Intronic
977439794 4:97050387-97050409 CCTCAGTTTTTGACAAAATATGG + Intergenic
978231892 4:106409810-106409832 TCTCAGATCTTGAGGAAAACCGG - Intergenic
978924205 4:114222902-114222924 TCTGAGTTTTTGAGGAAACATGG + Intergenic
979089858 4:116468686-116468708 CATCATTTGTTTAGGAAAAGTGG - Intergenic
980721442 4:136700711-136700733 TCTCAGTTTTTGAGGACACATGG - Intergenic
980827535 4:138090359-138090381 CCCAAGTGGTTGAGCAAAAAAGG + Intergenic
981561436 4:146052715-146052737 CCCCAGTTGCTTAGGAAAAATGG - Intergenic
983262350 4:165470747-165470769 CCTCAATTCTTTGGGAAAAATGG + Intronic
987379531 5:17272217-17272239 ACTCAGGTGTTGAGGGAATAAGG - Intronic
987557551 5:19473708-19473730 CCACAATTGCTGAGGAAGAATGG + Exonic
987749097 5:22016867-22016889 CCCCAGTTATTGAAGGAAAATGG - Intronic
987833072 5:23123988-23124010 CCTCAGTAGTTATGGCAAAATGG - Intergenic
989494003 5:42090293-42090315 TCTGAGTTACTGAGGAAAAATGG - Intergenic
990591499 5:57269953-57269975 CCTCACTTTTGGAGGAGAAAGGG - Intergenic
992628169 5:78653298-78653320 CCTTATTTGTAGAGAAAAAATGG - Intronic
992893556 5:81226987-81227009 TGTCAGTTGTTGAAGAAATAGGG + Exonic
993510677 5:88767935-88767957 CCACAGTGGGTGAGGAATAATGG + Intronic
994121211 5:96115132-96115154 ACTAAGTTTTGGAGGAAAAACGG - Intergenic
996463794 5:123776453-123776475 CCTCAGTTTTTGAATAAATAAGG - Intergenic
996668821 5:126092375-126092397 CCTTAGTGGTTGTGGACAAACGG + Intergenic
996760478 5:126981720-126981742 CCTTTGTTGTTTAAGAAAAAAGG - Intronic
997788509 5:136735897-136735919 TCTCAGATCTTGAGGAAAACCGG - Intergenic
999636385 5:153627389-153627411 CCTGAGTGGTTAAGGATAAAGGG - Intronic
999936957 5:156497216-156497238 CTTCTGTTATTGAGGAAAGATGG + Intronic
1001047685 5:168387364-168387386 CCTGAGCTGCTAAGGAAAAAGGG - Intronic
1003421400 6:5961435-5961457 ACTCATTAGTTGAGGAAACATGG - Intergenic
1003929613 6:10911238-10911260 CCCCAGTTGTTGAGAATAAGAGG - Intronic
1005143118 6:22656941-22656963 CCAGCCTTGTTGAGGAAAAATGG - Intergenic
1005343101 6:24862111-24862133 CCTCAGGTATTGAGGAAGTAGGG - Intronic
1006152367 6:31996369-31996391 CCTGGGTTCCTGAGGAAAAAGGG - Intronic
1006158668 6:32029107-32029129 CCTGGGTTCCTGAGGAAAAAGGG - Intronic
1006596923 6:35200450-35200472 CCTAAGTTGTTGAGGAAGTAGGG - Intergenic
1007739256 6:44000968-44000990 CCAAAGTTGTTGAGGAAGGAGGG + Intronic
1008687695 6:53943509-53943531 CCTCTGTTGTTGAAGAGAGAGGG - Intronic
1009777332 6:68221075-68221097 CCTCAATTATCGATGAAAAAAGG + Intergenic
1011243568 6:85298668-85298690 CCTCAGGTGTTGAGCACACATGG - Intergenic
1011290495 6:85772157-85772179 CCACAGTGGTTGAGGCAATAAGG + Intergenic
1011319958 6:86080402-86080424 CCTTGGTAGTTGAGGACAAAGGG - Intergenic
1011781090 6:90790163-90790185 CCTGTGCTGGTGAGGAAAAAGGG + Intergenic
1013873743 6:114799391-114799413 GCTTAGTTGTTTAGTAAAAAAGG + Intergenic
1014139159 6:117920376-117920398 TGGCAGTTGTGGAGGAAAAACGG - Intronic
1016888829 6:148985353-148985375 CCTCAGTTGGTGCTAAAAAATGG - Intronic
1020744877 7:12068399-12068421 CTTTAGTTGTAGAGGGAAAAGGG - Intergenic
1022131688 7:27410591-27410613 ACTCAGTTGCTGTGGAAAACAGG + Intergenic
1022347972 7:29536417-29536439 CCTCAGCTAATGAGGAATAAAGG - Intergenic
1022780216 7:33574296-33574318 CCACAGTTGGTGAGAAGAAAGGG - Intronic
1023709320 7:42975128-42975150 CCTCAGTGAATGAGGAAAAGTGG + Intergenic
1023925777 7:44668549-44668571 CCTCACTTGTTGAGGAGAAAGGG + Intronic
1026043097 7:66885386-66885408 CCTCAGTTTTTGAGGGACGAGGG - Intergenic
1029992958 7:104978933-104978955 TCTCAATTGTGGAGGAAGAATGG + Intergenic
1030630097 7:111886566-111886588 CCTCAGTTGTAAAGGATAAAAGG + Intronic
1032354803 7:131200725-131200747 CTTTAGTTTTTCAGGAAAAATGG - Intronic
1039569046 8:38572289-38572311 CTTCACTTGTTGAAAAAAAAAGG + Intergenic
1041694350 8:60720078-60720100 CCACAGTATTTCAGGAAAAAAGG - Intronic
1044078613 8:87856070-87856092 CCTCTGTTCTTGGGGAAAACAGG - Intergenic
1045763640 8:105641352-105641374 CCTCAGATGTTCATGAAACATGG - Intronic
1046383573 8:113480571-113480593 CCTCAGTAATTGAGGACAACTGG - Intergenic
1046809129 8:118513830-118513852 CCTCAGTTTTGGGGGAAAATGGG + Intronic
1048176707 8:132159295-132159317 CCTCATTCTTTGAGGAAAAAAGG + Intronic
1048383757 8:133892326-133892348 CATCTGTTGTTGGGGAAAAAAGG + Intergenic
1048512055 8:135071946-135071968 CCTCTGATGGTGAGGGAAAAGGG - Intergenic
1048524157 8:135186138-135186160 TCTCAGGTGTTCAGGAAAACTGG + Intergenic
1048546685 8:135394185-135394207 CCTCATTTCTGAAGGAAAAAGGG + Intergenic
1048658346 8:136568772-136568794 TCACAGTGGTTGAGGAAATAAGG - Intergenic
1049863647 8:144918992-144919014 ACTGAGTTTTAGAGGAAAAAAGG + Intergenic
1051212455 9:14758973-14758995 GCTCAGTTGATGAGGCAAATAGG - Intronic
1052477346 9:28976818-28976840 TCTCAAGTTTTGAGGAAAAAAGG + Intergenic
1053048378 9:34938303-34938325 CCTCAGTTCTTGAGGTAACAAGG - Intergenic
1053232949 9:36427075-36427097 CCTCATTTTTTGAGGAGGAAGGG + Intronic
1054964538 9:71007415-71007437 CGTGTGTTGTTGAGAAAAAATGG - Intronic
1055765659 9:79660802-79660824 CCTCAGGTGGTGAGCATAAATGG + Intronic
1059288348 9:113197773-113197795 CTTCAGTTATTGAAGTAAAATGG - Intronic
1062339031 9:136085771-136085793 CTTCAGATGTTTAAGAAAAAAGG - Intronic
1186662644 X:11684651-11684673 CTTCAGTTATTGAGGAAACTGGG + Intergenic
1187897547 X:23996886-23996908 ACTCAGTTTTTCAGGACAAAGGG - Intronic
1188259241 X:28002967-28002989 ACTCAGGTGTTTAGGAGAAAGGG - Intergenic
1188963574 X:36523390-36523412 CCACAGTGGTTGAGGTAACATGG + Intergenic
1189943964 X:46157859-46157881 CCTCAGATCATGAGGAAGAATGG - Intergenic
1190951059 X:55143285-55143307 TCTCAGATCTTGAGGAAAACTGG + Intronic
1193850849 X:86535889-86535911 TCTCAGATCTTGAGGAAAACCGG + Intronic
1193941017 X:87681129-87681151 TCTCAGATCTTGAGGAAAACCGG - Intergenic
1194589681 X:95784215-95784237 CCACAATTGTGGAGAAAAAATGG - Intergenic
1195670192 X:107463011-107463033 CCTCAGTGGTGGAGAAAAATAGG - Intergenic
1195687597 X:107600723-107600745 CCCCAGTTCCTGAGGACAAAGGG + Exonic
1196542888 X:116930418-116930440 TCTCAGATCTTGAGGAAAACTGG + Intergenic
1198081468 X:133244062-133244084 GCTCAGTTCTTGAGGAAGAACGG + Intergenic
1198201886 X:134429743-134429765 CCTCAGTTGTGTAGGCAAAATGG + Intergenic
1199016684 X:142825087-142825109 CCTCAGTTGAGGATGAAAAATGG + Intergenic
1200322878 X:155208035-155208057 CCTCACTGATTGAGGAAATATGG - Intronic
1201616795 Y:15909348-15909370 CCTCAGTTTATGAAGATAAAGGG + Intergenic