ID: 1068223844

View in Genome Browser
Species Human (GRCh38)
Location 10:54080821-54080843
Sequence CCTTCTGTACTGTAGGAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 128}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068223844 Original CRISPR CCTTCTGTACTGTAGGAAGC TGG (reversed) Intronic
900073800 1:795495-795517 TCTTCTGTAATGTAGCATGCTGG - Intergenic
901068538 1:6506134-6506156 GTTTCTCTACTGGAGGAAGCGGG - Intronic
902730411 1:18365290-18365312 CCTGCTGTCCTGTAGGGGGCCGG - Exonic
905861738 1:41356691-41356713 CCTTCTGTACCATGGGAAGGAGG - Intergenic
907871063 1:58443275-58443297 CCTCCTGTACTGTGAGAGGCTGG - Intronic
909070567 1:70988535-70988557 CCTTCTGGTCAGTAGGAAGGAGG - Intronic
912375868 1:109209603-109209625 ACTACTGTACTGTGGGAAACGGG + Intergenic
916452833 1:164937637-164937659 CCATCTCTACAGGAGGAAGCAGG + Intergenic
916759731 1:167805583-167805605 CCTTCTGTATACTAGGCAGCAGG + Intergenic
916997034 1:170312211-170312233 CCCTCTAGAGTGTAGGAAGCAGG + Intergenic
918147980 1:181774628-181774650 CCATCTCTACTCTAGGCAGCAGG + Intronic
918200993 1:182266754-182266776 CCATCTGCACAGCAGGAAGCAGG + Intergenic
919056413 1:192575285-192575307 TCTTCTTTTCTGCAGGAAGCAGG - Intergenic
919155456 1:193759502-193759524 CCTTATGTAATGTAGGATACAGG - Intergenic
920650143 1:207831569-207831591 CCTCCTGTATTTTAGGCAGCAGG - Intergenic
921696105 1:218213025-218213047 CCTTCTGCACAGTATGAAGCTGG + Intergenic
921933909 1:220778384-220778406 GCTTCTGCCATGTAGGAAGCTGG - Intronic
922269659 1:224020403-224020425 TCTTCTGTAATGTAGCACGCTGG - Intergenic
922346380 1:224699999-224700021 CCTACTGGACTGTAGGAAGGTGG + Intronic
922926045 1:229347377-229347399 CCTTCAGTACTGTATGAACAAGG + Intergenic
924266004 1:242282966-242282988 CCTTCTGTGCTAAAGGAAACTGG - Intronic
1065827734 10:29587297-29587319 GCTTGTGTCCTGTACGAAGCCGG - Intronic
1065950125 10:30644006-30644028 GCTTGTGTCCTGTACGAAGCCGG + Intergenic
1066718833 10:38315571-38315593 CCTTCTGTGCTAAAGGAAACTGG + Intergenic
1068223844 10:54080821-54080843 CCTTCTGTACTGTAGGAAGCTGG - Intronic
1073051413 10:100669748-100669770 CCATCTGTACAGTGGGAAGCAGG - Intergenic
1074970045 10:118528615-118528637 CTTTCTCTACTCTAGGAATCTGG + Intergenic
1083331572 11:61900774-61900796 CCTGCTGCACTGGATGAAGCTGG - Intronic
1083694136 11:64431340-64431362 CTTTCTATACTGTTGGAATCTGG + Intergenic
1085090503 11:73708734-73708756 TTTTCTGTGTTGTAGGAAGCAGG - Intronic
1088616335 11:111632973-111632995 TCTTCTGTACTTTTGGAAACTGG + Intronic
1090873451 11:130768291-130768313 CCTTCTCTACTGTAGATAGCAGG + Intergenic
1091018176 11:132073079-132073101 CCTTCTGTCCTGTGGGCTGCTGG + Intronic
1095155167 12:38843831-38843853 CCTTCTGTCCTGCAAGGAGCTGG + Intronic
1095272980 12:40242591-40242613 CCTTCTGGAATGGAGGAAACAGG + Intronic
1105473681 13:20713433-20713455 CCTGCTGTATTTTAAGAAGCTGG - Intronic
1107748930 13:43543545-43543567 AGTCCTGTACTGTGGGAAGCAGG - Intronic
1107806217 13:44156239-44156261 CCTTCTGTTTTGTGGGAGGCAGG + Intronic
1111557972 13:89906226-89906248 CTTTCTGTACTGCAAGCAGCAGG + Intergenic
1113063963 13:106355679-106355701 CCTTCTGTTATGTGGGATGCAGG + Intergenic
1116668977 14:47817089-47817111 CCTTCTGCAGTGGAGGTAGCAGG + Intergenic
1122025328 14:98871791-98871813 CCTTCTGTACAATGGGAAGTGGG - Intergenic
1123632876 15:22274265-22274287 CCTTGTGCAGTGTAAGAAGCTGG + Intergenic
1127331222 15:57941961-57941983 GCTTCTCTAGTGTAGCAAGCTGG - Intergenic
1128724353 15:69976791-69976813 CCTTCTGATCTGTAGTCAGCTGG + Intergenic
1136228840 16:28875561-28875583 CCTTGTGTCCTGTAGGGAGATGG + Intergenic
1136991325 16:35152926-35152948 CCTTCTGTGCTGTAGTCAGAGGG - Intergenic
1141970185 16:87476502-87476524 CCTTGTGCAGTGTAAGAAGCTGG - Intronic
1144629583 17:16864091-16864113 CCTTCTGGAATGTGGGAAGGCGG - Intergenic
1144651845 17:17012026-17012048 CCTTCTGGAATGTGGGAAGGCGG + Intergenic
1149062976 17:52445953-52445975 CATTCTGTACTGTAGGCAGTTGG + Intergenic
1149210437 17:54294381-54294403 CCTTCTCTACTCTAGGAAGAAGG - Intergenic
1153361242 18:4199202-4199224 CCTTCTGTCCTGGAGGAGGGTGG + Intronic
1161429654 19:4224264-4224286 CCTTCTGTACAGTGGGAGGCTGG + Intronic
1163304466 19:16469173-16469195 CCTTCTGGACTCTAGAAGGCAGG + Intronic
1163651357 19:18520194-18520216 TCTTCTGTGCTTTAGGAACCAGG - Intronic
1166538581 19:43591498-43591520 CCTTCTGTCCTGAAGGGAGTTGG - Exonic
925312645 2:2896788-2896810 TCTTCTGTACTGTAGCAATCGGG - Intergenic
926172084 2:10558831-10558853 CCTCCTGGAGTGCAGGAAGCAGG - Intergenic
926380229 2:12279575-12279597 CCGTCTATACCTTAGGAAGCTGG + Intergenic
928312403 2:30221781-30221803 CCTTCTGTACACAGGGAAGCGGG - Intergenic
928983379 2:37157611-37157633 CCTGGGGTACTGTAGGAAGCAGG - Intergenic
934504609 2:94880518-94880540 CCCACTGTACTGTGGGATGCTGG - Intergenic
935235192 2:101132422-101132444 CATACTGTACTGAAGGGAGCAGG - Intronic
935657919 2:105440846-105440868 CCCTCTGTACTGCAGGAGCCAGG - Intergenic
935742956 2:106167046-106167068 CCTTCTATACTCTAGGCACCTGG + Intronic
936598183 2:113869506-113869528 CCTTCTGTATGGTAGGGAGCAGG - Intergenic
941684989 2:168439121-168439143 ACTTCTGTACATTAGGAGGCAGG + Intergenic
943258214 2:185625019-185625041 CCTTATGTATGGTAGGAAGAAGG + Intergenic
943675290 2:190710987-190711009 CAGTCTGCACTGTATGAAGCTGG - Intergenic
943772689 2:191735560-191735582 CATTTTGTACTGGAAGAAGCTGG + Intergenic
944154616 2:196596291-196596313 CCTTCTGTGTTGTTGGAAGAGGG - Intergenic
944417328 2:199491890-199491912 CCTTCTGGACAGAAAGAAGCGGG - Intergenic
948236149 2:236392343-236392365 CCTTCTGGAGTGTAGAAATCTGG - Exonic
948468032 2:238161484-238161506 CCTTCTGTACTCTGGGACCCTGG - Intronic
1169604540 20:7302080-7302102 TGTTTTGTACTGGAGGAAGCTGG - Intergenic
1174249415 20:49207330-49207352 CCTTCTGTCCTGGAGGAGCCAGG + Intergenic
1175295861 20:57908300-57908322 CCTTCTGGTGTGGAGGAAGCAGG + Intergenic
1175363533 20:58433908-58433930 CCAGCTGTACTCTAGGAAGTAGG + Intronic
1176977353 21:15337151-15337173 TCTTTTGTATGGTAGGAAGCAGG - Intergenic
1181957251 22:26596938-26596960 CCTGCTGTACTGTTAGAAGTTGG - Intergenic
1182930315 22:34167389-34167411 ACTACTGGACTGTAGGAAGGTGG - Intergenic
1183010684 22:34944242-34944264 CCTTCTCTAGTGGAGGAACCAGG - Intergenic
1183122538 22:35741246-35741268 CTTTCTGTACTCTTGGAAGCTGG - Intronic
1184876293 22:47277793-47277815 CCTTCTGCACTGTGAAAAGCTGG - Intergenic
1185248765 22:49788436-49788458 ACTTCTGTGCTGTGGGGAGCGGG - Intronic
949113396 3:290631-290653 CCTACTGTACTCTAGGAACAGGG - Intronic
950653288 3:14421140-14421162 CCTTCGGGACTTTAGGAAACGGG + Intronic
951576897 3:24123402-24123424 CCTTCTGTACCCTAGGAGGGAGG - Intronic
952410857 3:33048597-33048619 CCTGCTCTCCTCTAGGAAGCTGG + Intronic
954353464 3:50065087-50065109 CCTTCTTCACAGTAGGAGGCAGG - Exonic
957007206 3:74963585-74963607 ACTTCTGTGCTTTAGGGAGCTGG - Intergenic
961250624 3:125501645-125501667 CCATCTGTACTGAAAGCAGCTGG + Intronic
961455643 3:127022631-127022653 CCTTCGGTGCTGTAGGAAGGGGG + Intronic
961652798 3:128425724-128425746 CCTCCTGTCCTGTGGGCAGCAGG + Intergenic
965460082 3:168951796-168951818 AATTCTATAATGTAGGAAGCAGG + Intergenic
969386367 4:6851875-6851897 CCTGCTGTGCTGTGTGAAGCTGG - Intronic
969701703 4:8771257-8771279 CCGTCTGTACTGCAGGACCCTGG - Intergenic
972556065 4:40182355-40182377 CCTTTTGTCCTGTAGGCAGTAGG + Intergenic
973339925 4:48993501-48993523 CCTTCTGTCCTGTAGAGGGCTGG + Intronic
973926829 4:55747487-55747509 CCATCTGTAAGCTAGGAAGCAGG + Intergenic
973948251 4:55983323-55983345 CCTTCTGGGTTGTAGGAGGCAGG + Intronic
976391719 4:84512398-84512420 CTGTGTGTACTGAAGGAAGCAGG + Intergenic
977048809 4:92100929-92100951 CCTTCTGTACTGGAAGAAAAAGG - Intergenic
983729127 4:170971741-170971763 CTTTCATTCCTGTAGGAAGCTGG + Intergenic
984755136 4:183318980-183319002 CCTTCTATACTGTCAGAGGCAGG - Exonic
987088329 5:14489016-14489038 CCATCTGCCCTGTAGGAAACAGG - Intronic
990749393 5:58997077-58997099 ACTTCTCTACTCTAGGAAGACGG + Intronic
995003740 5:107165830-107165852 CCCTATGTAGTGTAGGAGGCAGG - Intergenic
997889257 5:137660411-137660433 CCCACTGTCCTGTGGGAAGCTGG - Intronic
998080836 5:139273943-139273965 CCTTCTCTCCTCTAAGAAGCAGG + Exonic
998098560 5:139412795-139412817 CCTGCTGCTCTTTAGGAAGCAGG - Exonic
998885592 5:146690804-146690826 CCTTCTGTACTGAAGGTACAGGG - Intronic
999633185 5:153592837-153592859 CCATCTGTAAACTAGGAAGCAGG - Intronic
1001790420 5:174452658-174452680 CCTTCAGTGCTGTAGAATGCTGG - Intergenic
1003532715 6:6951577-6951599 CTTTCTGTGCTGCAGGCAGCAGG + Intergenic
1004019844 6:11767487-11767509 AGTTCTGTACTATAGGAAGCAGG + Intronic
1008674298 6:53803097-53803119 TCTTCTGTACTGTAACAAACAGG + Intronic
1014052256 6:116968529-116968551 CCTTGTGTCCTGCAGGAAGAAGG + Intergenic
1019666890 7:2256481-2256503 CCATCTGCTCTGGAGGAAGCCGG + Intronic
1021881712 7:25101394-25101416 CTTACTGTAATGTTGGAAGCTGG - Intergenic
1021909022 7:25365588-25365610 GCTTCTGTGCTGTAGGCAGCTGG + Intergenic
1023927516 7:44680697-44680719 CATCCTCTACTGGAGGAAGCTGG + Intronic
1024794647 7:53007032-53007054 CTTTCTGTACGGCAGGCAGCAGG - Intergenic
1025763588 7:64418492-64418514 CCATGTGTACAGTAAGAAGCAGG - Intergenic
1026909678 7:74084505-74084527 CCTTCTGTACATTTGGAAACTGG + Intronic
1033789736 7:144777164-144777186 GCTTCTGCTCTGTAGGAAGTGGG + Intronic
1035541847 8:446085-446107 TCTTCTGTAATGTAGCATGCTGG + Intronic
1037047117 8:14320758-14320780 CAGTCTGTCATGTAGGAAGCTGG + Intronic
1037695589 8:21221337-21221359 CCTACTGAACTGTGGGGAGCTGG - Intergenic
1039851055 8:41365368-41365390 CATTCTGTACTCTTGGAAGGAGG - Intergenic
1041468328 8:58180407-58180429 CGTTCTCTGCTGTAGGAGGCAGG - Intronic
1041969553 8:63722589-63722611 ACTTCTGTAATTTAGGAAACAGG - Intergenic
1042541889 8:69915683-69915705 CCTTCTGCAATTCAGGAAGCAGG + Intergenic
1042743313 8:72075607-72075629 ACTTTTGTAGTGCAGGAAGCAGG + Exonic
1044057438 8:87588635-87588657 CATTCTGTTCTGTAGGCACCAGG + Intronic
1044528867 8:93285040-93285062 ACTTCTTTGCTGAAGGAAGCTGG - Intergenic
1046419378 8:113959638-113959660 CCTGGTGTACTGCAGGAAGGAGG - Intergenic
1052201074 9:25781021-25781043 TCTTCTGTACTGAAGGAAAAGGG - Intergenic
1053826274 9:42028021-42028043 CCTTCTGTACTAAAGGAAGATGG + Intronic
1054604286 9:67159376-67159398 CCTTCTGTACTAAAGGAAGATGG - Intergenic
1060944491 9:127561917-127561939 ACTTCTGTGCTGGAGGAAGAAGG - Intronic
1195654326 X:107320574-107320596 CAATCTGTAGTGTAGGTAGCAGG + Intergenic
1195850093 X:109273548-109273570 CCTTCTGTTCTGTAAGAGCCAGG - Intergenic
1197268511 X:124401369-124401391 CCTTCTGTACTGTGGGAAATGGG - Intronic
1202018243 Y:20434794-20434816 CCTTCAGTATTGGAGCAAGCTGG - Intergenic