ID: 1068224340

View in Genome Browser
Species Human (GRCh38)
Location 10:54087185-54087207
Sequence AATTGTACCCTTTAAATTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 377
Summary {0: 1, 1: 3, 2: 17, 3: 59, 4: 297}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1068224340 Original CRISPR AATTGTACCCTTTAAATTGG TGG (reversed) Intronic
900202251 1:1414407-1414429 AAATGTAACCTTAAAATTTGAGG - Intergenic
901412242 1:9092584-9092606 AATTGAACCCTTTTTACTGGGGG - Intergenic
901566894 1:10124080-10124102 AATTGTACACTTCAAAATGATGG - Intronic
905136822 1:35807005-35807027 CATCGTACCTTTTCAATTGGTGG + Intergenic
905520589 1:38596540-38596562 AATGGTGCCTTTTAATTTGGTGG + Intergenic
907834198 1:58093660-58093682 GGTTGCACCCTTTAAACTGGTGG - Intronic
908327863 1:63041576-63041598 AATTCTACACTTCAAAATGGTGG + Intergenic
909213695 1:72857836-72857858 TATTGTACCCTGTAAAATGAAGG - Intergenic
910071742 1:83223474-83223496 AATTATACCAATTAGATTGGAGG - Intergenic
911297143 1:96131914-96131936 AGATGGACCCATTAAATTGGAGG - Intergenic
912311744 1:108629228-108629250 AATTATACCTTTCAAATTGGTGG - Intronic
912344485 1:108952079-108952101 AACTGGACACTTTAAATGGGTGG + Intronic
913302857 1:117390939-117390961 AATTGTATACTTTAAATGGGTGG - Intronic
913648502 1:120886199-120886221 AAATTTACCCTTTAATTTTGGGG + Intergenic
913940156 1:125095599-125095621 CATTGTATGCTTTAAAATGGTGG + Intergenic
914078191 1:144377162-144377184 AAATTTACCCTTTAATTTTGGGG - Intergenic
914100988 1:144589339-144589361 AAATTTACCCTTTAATTTTGGGG + Intergenic
914173099 1:145245696-145245718 AAATTTACCCTTTAATTTTGGGG - Intergenic
914297991 1:146348316-146348338 AAATTTACCCTTTAATTTTGGGG - Intergenic
914527754 1:148486835-148486857 AAATTTACCCTTTAATTTTGGGG - Intergenic
914638636 1:149580230-149580252 AAATTTACCCTTTAATTTTGGGG + Intergenic
914883200 1:151563783-151563805 AATTCCACCCAGTAAATTGGTGG + Intronic
919539634 1:198830896-198830918 AATTTTCCCATTTAAATTAGGGG - Intergenic
920939008 1:210463195-210463217 AACTGTACACTTTAAATGGGTGG - Intronic
921450385 1:215298531-215298553 AATTGTACAATTTAAATATGTGG - Intergenic
923359538 1:233196997-233197019 AACTGTACACTTGAAATTAGTGG + Intronic
923592765 1:235334469-235334491 AAATGTACACTTTAAATGGGTGG - Intronic
1062822329 10:543776-543798 AATTGTACCCTTTAATATGGGGG - Intronic
1063422778 10:5926777-5926799 AATTGTACACTTTGGATGGGTGG - Intronic
1063775735 10:9261557-9261579 AATTGTTCTGTTTAAATGGGTGG - Intergenic
1065086018 10:22177538-22177560 AATTTTATACTTTAAATGGGTGG + Intergenic
1065508714 10:26456202-26456224 AATTATACACTTTAAATAGGTGG + Intronic
1067072469 10:43144673-43144695 AATTGCACACTTTAAATATGTGG - Intronic
1068224340 10:54087185-54087207 AATTGTACCCTTTAAATTGGTGG - Intronic
1068743174 10:60498259-60498281 AACTGTGCTCTGTAAATTGGAGG - Intronic
1069846530 10:71375925-71375947 GATTGATCCCTTTAAATTGAGGG + Intergenic
1070360077 10:75679748-75679770 AATGATACACTTTAAATTAGTGG - Intronic
1070716242 10:78724075-78724097 AACTGTACCCTTAAAATGGGTGG + Intergenic
1071824741 10:89313977-89313999 AATTGTATACTTTAAATGAGTGG + Intronic
1072100276 10:92223133-92223155 AATTGTACCCTGAGAATTAGAGG - Intronic
1072497639 10:95978041-95978063 AATCATACACTTTAAAATGGTGG + Intronic
1073695045 10:105856836-105856858 AATTCTACCCAACAAATTGGAGG + Intergenic
1074382823 10:112994111-112994133 AATTGTACACCTCAAATAGGTGG - Intronic
1074611552 10:115026878-115026900 AATTATACCCTCTAAATGAGGGG + Intergenic
1074625063 10:115174436-115174458 AACTGTATCCTATAAATTGGAGG - Intronic
1074787758 10:116856376-116856398 CATTGTCCCCTTGAAATTGGTGG + Intronic
1075488156 10:122844427-122844449 AATTGTATACTTTAAAATGGTGG + Intronic
1075635622 10:124028486-124028508 AATTGTTCACATTAAATGGGTGG - Intronic
1076622381 10:131799905-131799927 AATTGTACCCTTTAAATATGTGG + Intergenic
1078771129 11:14353144-14353166 AATTGATAACTTTAAATTGGGGG - Intronic
1079459276 11:20665884-20665906 AATTGTATACTTTAAATGGGTGG - Intergenic
1080372695 11:31670261-31670283 AAATGTACCCTTCAAATTGAGGG + Intronic
1080509224 11:32950585-32950607 AACTGTACACTTTAAATGGGTGG - Intronic
1080680769 11:34473749-34473771 ACTCGTACACTTTAAATGGGTGG - Intergenic
1081881022 11:46452071-46452093 AAATGTATACTTTAAATAGGTGG + Intronic
1081964901 11:47163586-47163608 AATGGGACCCTTTAAATTTAGGG - Intronic
1084375826 11:68776829-68776851 AATTGTACACTTTTAAAGGGTGG + Intronic
1084543548 11:69801932-69801954 AATTGTACTCCTTAAACAGGTGG - Intergenic
1086335918 11:85800580-85800602 AGTTGTACCTTTTAAATTCCTGG - Intronic
1087378547 11:97375152-97375174 AATTGTACATTTTAAATGGATGG + Intergenic
1087995562 11:104803340-104803362 AATTGTTCACTTTAAATGGATGG + Intergenic
1088711174 11:112510017-112510039 AATTGTACACTTTAAACAGGTGG - Intergenic
1088845712 11:113664641-113664663 AATTGTACACTTTAAAAGGATGG - Intergenic
1090082160 11:123620998-123621020 AATGGGGCCCTTTAACTTGGGGG + Intronic
1093372929 12:18386314-18386336 AATCGCACACTTTAAATGGGAGG - Intronic
1095050735 12:37552088-37552110 AATTTTACACTTTAAATGGGTGG + Intergenic
1095054054 12:37579678-37579700 AATTTTACACTTTAAATCAGTGG + Intergenic
1095194092 12:39292229-39292251 AATTTTACCTTTTAAAATGCTGG - Intergenic
1095859394 12:46899211-46899233 AAGTGTACTCTTTAAATTGGTGG + Intergenic
1096641359 12:52997004-52997026 AATTGTATACTTTCAATGGGTGG - Intergenic
1096935818 12:55274256-55274278 GATTGTACACTTTAAATGTGTGG + Intergenic
1097308731 12:58096083-58096105 AATATTAACATTTAAATTGGGGG + Intergenic
1097602242 12:61707067-61707089 AATTCTCCCCATTAAATTAGTGG + Intergenic
1097829801 12:64212179-64212201 AATTGTACACTTTAAAAGGTTGG - Intronic
1099393471 12:82108667-82108689 CATTGTACCTTTTAAACAGGTGG + Intergenic
1099609448 12:84849041-84849063 AATTGAAATCTTTAAAATGGAGG + Intergenic
1100187975 12:92158142-92158164 AATTGCACACTTGAAATGGGAGG - Intergenic
1101035279 12:100699652-100699674 AATTGTACACTTTGAATGTGTGG - Intergenic
1101037505 12:100719566-100719588 AATTGAACCCTATAAATTCCAGG - Intronic
1101455241 12:104824842-104824864 AATTTTACCTTTTCAACTGGGGG + Intronic
1101671143 12:106874640-106874662 AATTTTAACTTTTACATTGGTGG - Intronic
1103821344 12:123701365-123701387 AATTGCACACTTTAAGTAGGTGG + Intronic
1104340118 12:127941152-127941174 AATTGTACCCTTTAAATGAACGG - Intergenic
1106199088 13:27521251-27521273 AATTGTACACTTTAAAATGGTGG + Intergenic
1106443847 13:29805568-29805590 AATAGTCTCCTTTAACTTGGGGG + Intronic
1106497456 13:30293555-30293577 AACTGTACACTTAAAATTAGTGG - Intronic
1106961689 13:35006076-35006098 AATTCTTGTCTTTAAATTGGAGG + Intronic
1107128485 13:36869913-36869935 AATTGTACATTTGAAATGGGTGG + Intronic
1108240746 13:48461040-48461062 AATTGTACATTTTAAATGGGTGG - Intronic
1109925300 13:69128892-69128914 AAATGGACTATTTAAATTGGAGG + Intergenic
1110207233 13:72929602-72929624 AATTGTACACTTTAAATTGGTGG + Intronic
1110375199 13:74785602-74785624 CATTGTACCCTTTTTATTGCAGG + Intergenic
1112781665 13:102907264-102907286 AATTGTACACTTTAAATACATGG + Intergenic
1114428719 14:22642233-22642255 AATTGTATATTTTAAATGGGTGG - Intergenic
1114808600 14:25869013-25869035 AATTGTCCACTCTTAATTGGTGG - Intergenic
1115022569 14:28700777-28700799 AATAGTACCTTTTATATTGTAGG - Intergenic
1115901902 14:38161028-38161050 AAATATATCCTTTAAATTTGTGG - Intergenic
1117672095 14:58118531-58118553 AAGTTTACCCTTTACATAGGGGG + Intronic
1117791352 14:59345207-59345229 AATTGTTCCATTTAAGTAGGGGG + Intronic
1118698433 14:68409135-68409157 AACTGTACACTTGAAATTGGAGG + Intronic
1119707598 14:76794248-76794270 AATTATACACTTAAAATGGGTGG + Intronic
1119785601 14:77311362-77311384 CATTGCACACTTTAAAATGGTGG - Intronic
1121827477 14:97022265-97022287 AATTGCTCCTTTTAAAGTGGGGG + Intergenic
1125009887 15:34859831-34859853 AATTTTACACTTTAAGTTTGTGG + Intronic
1125526421 15:40378459-40378481 AATTGTACACTTAAAATATGTGG + Intergenic
1128214715 15:65926339-65926361 AATTTTTCCCCTTAAAGTGGGGG - Intronic
1128808779 15:70555042-70555064 AATTGTAGCCTCTACATGGGTGG - Intergenic
1129519025 15:76174245-76174267 AATTGTGGACTTTAAATGGGTGG - Intronic
1129589036 15:76898879-76898901 AAGTGTACATTTTAAATGGGTGG + Intronic
1129639862 15:77364280-77364302 AATTTTACACTTTAAATGGGTGG + Intronic
1130526704 15:84713219-84713241 AATGGTACACTTTAAATGGATGG + Intronic
1131587655 15:93713639-93713661 AATTGCAACTTTTAAATTGAGGG - Intergenic
1136769191 16:32819831-32819853 CATTGTATGCTTTAAAATGGTGG + Intergenic
1137298807 16:47125855-47125877 AATTGTAAACTTAAAAATGGTGG - Intronic
1137304905 16:47189240-47189262 AATTGTACACTGTAAACTGGTGG - Intronic
1138041889 16:53680362-53680384 AGATGTGCCCTTTAAATTAGGGG + Intronic
1138790407 16:59897170-59897192 AATTGTATACCTTAAATTGTTGG + Intergenic
1140140712 16:72254644-72254666 AATTGTACACTTTAAATGGGTGG - Intergenic
1141380838 16:83575273-83575295 AATTGTACACTTTAAATAGGTGG + Intronic
1141607365 16:85162128-85162150 AATTGTACACTTTAAATGGGCGG + Intergenic
1203071607 16_KI270728v1_random:1081938-1081960 CATTGTATGCTTTAAAATGGTGG + Intergenic
1144254252 17:13450342-13450364 AAATGTACCCCTTACATTGGTGG + Intergenic
1144399231 17:14879139-14879161 AATTGTATACTTTAAGTGGGTGG + Intergenic
1145371356 17:22308922-22308944 AATTTTACACTTTAAATGGGTGG + Intergenic
1145374592 17:22335736-22335758 AATTTTACACTTTAAATCAGTGG + Intergenic
1148948888 17:51291235-51291257 AATTATACCTTTTAAAATGGGGG + Intronic
1149167650 17:53772631-53772653 AACTGTACACTTAAAAATGGCGG - Intergenic
1149198948 17:54160179-54160201 AATTGTCCCCTTTAAAATTTTGG + Intergenic
1149326964 17:55541483-55541505 AATTGTACACTTTATATTCTTGG - Intergenic
1149849859 17:60027858-60027880 AACTGTACCCTAAAAATGGGTGG - Intergenic
1149860309 17:60118666-60118688 AACTGTACCCTAAAAATGGGTGG + Intergenic
1151025795 17:70674789-70674811 ATTTGTACCATTTAAATGTGAGG - Intergenic
1151962527 17:77414377-77414399 AATTATGCACTTTAAATGGGTGG - Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153734039 18:8045785-8045807 AATTGTACACTTTACATGGGTGG + Intronic
1153912453 18:9716065-9716087 AACTGGACCCTTTAAATAGCTGG - Intronic
1155344453 18:24844833-24844855 AATTGTGCACTTTAAATGAGTGG - Intergenic
1156095313 18:33524661-33524683 AATTGTCCCCTTTAAAATATTGG - Intergenic
1156792502 18:40992667-40992689 AATTGTACCCATTAAATAGGGGG - Intergenic
1157060699 18:44285707-44285729 AATTATACACTTTTACTTGGGGG + Intergenic
1157375791 18:47163439-47163461 ATTTATACACTTTAAATTGTGGG - Intronic
1157961896 18:52163576-52163598 AATTGTACCCTGCAATTTTGGGG + Intergenic
1158392719 18:57056741-57056763 AATTGTGCACTTTAAAATGGTGG - Intergenic
1159465639 18:68779872-68779894 AACTGTACATTTTAAATGGGTGG - Intronic
1160594152 18:79962771-79962793 AATTATGCCCTTTAAATGGGTGG - Intergenic
1161104299 19:2435645-2435667 AACTGTACACTTTAAAAAGGTGG + Intronic
1161706452 19:5824365-5824387 AATTCTACCCCTTACGTTGGGGG - Intronic
1163449974 19:17371087-17371109 AATTGTACACTTTAAATAGGTGG + Intronic
1165632654 19:37314916-37314938 AATTTTACACTTTCAATGGGTGG - Intronic
1165801609 19:38554929-38554951 AACTGTACATTTTAAATGGGTGG - Intronic
1166033532 19:40150760-40150782 AATCGTATCTTTTAAATTGGTGG + Intergenic
1166961567 19:46499705-46499727 AGTTGTGCACTTTAAATGGGTGG - Intronic
1166969440 19:46554807-46554829 AATTGTAACCTTTAAATGGATGG + Intronic
1167139128 19:47637563-47637585 CATTGTACCCTTTACATGGCTGG - Intronic
1202672225 1_KI270709v1_random:66348-66370 CATTGTATGCTTTAAAATGGTGG - Intergenic
925047647 2:786193-786215 AATTTTAGCCATTAAATTTGTGG + Intergenic
925312447 2:2894946-2894968 ATTTGTAGCCTTTACATTGCAGG - Intergenic
926510108 2:13765598-13765620 AACTGTACACTTAAAATTGGTGG + Intergenic
928311908 2:30218218-30218240 AATTTTACCTTTGAATTTGGCGG - Intergenic
930074376 2:47394818-47394840 AATTGTACACTTTAAGTGGGTGG + Intergenic
930116123 2:47719863-47719885 GATTTTACCCTTAAAATTTGAGG + Intronic
930406234 2:50959706-50959728 AATTGTACACTTTAATTTTATGG + Intronic
931777623 2:65553912-65553934 AATTGTATGCTTTAAAGTGATGG + Intergenic
932636398 2:73392384-73392406 AATTGTGCACTTTAAATTAAAGG - Intronic
932985390 2:76720459-76720481 AATTGAACCCGTTAATTGGGAGG + Intergenic
934045051 2:88166322-88166344 GATTGTACACTTTAAAGAGGTGG - Intergenic
936654892 2:114473706-114473728 CAATGTAACCTTTAAATTGATGG + Intronic
936860669 2:117014919-117014941 AATTGTACACTTAAAACAGGTGG - Intergenic
938898154 2:135773251-135773273 AATGGTATCCTTTAGATTGCTGG - Intronic
939375110 2:141355332-141355354 AATTGTACACTTTATAAGGGTGG - Intronic
940482212 2:154248501-154248523 AATAGTACTTTTTAAACTGGAGG + Intronic
940499170 2:154473495-154473517 AACTGTACCCTTGAAATTCAGGG + Intergenic
941091239 2:161178625-161178647 AAGTGTACACTTTAAAATAGTGG + Intronic
941131807 2:161660132-161660154 AATTGTGCACTTTAAATGGTTGG + Intronic
942304857 2:174597310-174597332 TATTTTCCCATTTAAATTGGGGG - Intronic
942705590 2:178768228-178768250 AATTGTATACTTTAAATTGGTGG - Intronic
943293458 2:186106265-186106287 AATTGAAGCCTTTAAATCTGTGG + Intergenic
943312187 2:186339820-186339842 AATTGTATACTTGAAATTGGTGG - Intergenic
943589598 2:189781793-189781815 AACTATACACTTTAAATGGGTGG + Intronic
946119792 2:217500067-217500089 AATTGTATACTTTAAAATGGTGG + Intronic
1170281863 20:14658449-14658471 AACTGTACTCTTAAAATTAGAGG + Intronic
1170676738 20:18488994-18489016 AATTGTAGTTTTTAAATTTGGGG - Exonic
1171528212 20:25832674-25832696 AATTTTACACTTTAAATCAGTGG - Intronic
1171545245 20:25995561-25995583 AATTTTACACTTTAAATGGGTGG + Intergenic
1171548614 20:26023204-26023226 AATTTTACACTTTAAATCAGTGG + Intergenic
1172868348 20:38118196-38118218 AATTGTACACTTCAAACAGGCGG - Intronic
1174065422 20:47861193-47861215 AAATGTTCACTTAAAATTGGTGG + Intergenic
1174816702 20:53693305-53693327 GTTTGTACACTTTAAATTAGTGG - Intergenic
1175253263 20:57622534-57622556 AATAGTGCTCTTTAAATGGGGGG + Intergenic
1175705999 20:61177244-61177266 AATTGTATGCTTAAAAATGGTGG + Intergenic
1175843480 20:62046253-62046275 AATTGCACACTTAAAATAGGTGG - Intronic
1176227970 20:64013780-64013802 AATCGTAAACTTTAAATGGGTGG - Intronic
1178045778 21:28693117-28693139 AAATGTACACTTTAAAAGGGGGG + Intergenic
1178542294 21:33463599-33463621 AATTGTACACTTTAAATTGGTGG + Intronic
1179052390 21:37898823-37898845 AATTGTACTTTTTAAAAGGGAGG + Intronic
1179181451 21:39048665-39048687 AATTGTACGCTTTAAATGGTAGG - Intergenic
1179435010 21:41355796-41355818 AATTGTACACTTTACATTGGTGG + Intronic
1179524172 21:41965001-41965023 AATGATACACTTTAAAATGGTGG + Intergenic
1179635546 21:42706338-42706360 GGTTGTACACTTTAAAATGGTGG - Intronic
1180845631 22:18979968-18979990 AATTCTACCCTTTAAAGTGGTGG + Intergenic
1182388377 22:29967577-29967599 AATTGTATACTTTAAAAGGGTGG - Intronic
1184845342 22:47080555-47080577 AAATGTAACCTTTGAATTTGTGG + Intronic
949566380 3:5248903-5248925 AATTATACAGTTTAAATGGGTGG + Intergenic
950329578 3:12145853-12145875 AATCCTACCCTTTTACTTGGGGG - Intronic
950865632 3:16186902-16186924 AATTGTACACTTTATAAAGGTGG + Intronic
951515848 3:23558604-23558626 TACTGTAACTTTTAAATTGGAGG + Intronic
951905792 3:27705951-27705973 AATTGAACTCTTTAGATTGGTGG + Intergenic
951948859 3:28175382-28175404 AATTCTACCCTTGAATTTGTGGG - Intergenic
953847592 3:46440134-46440156 AATTGTACACTTTGCATGGGTGG + Intronic
954521900 3:51235647-51235669 CATTGTATCTTTTAAACTGGAGG + Intronic
955623652 3:60893456-60893478 ATTTGTACACTTTAAAGTGTAGG - Intronic
958271086 3:91500630-91500652 AACTATACCCTTTAAATGGGTGG + Intergenic
958704468 3:97637001-97637023 AATAGTACCCTTGAAATTAGAGG - Intronic
958741903 3:98084047-98084069 AATTGTAGCCTTTGAGTTAGTGG + Intergenic
958774220 3:98462077-98462099 AAATGGACACTTGAAATTGGTGG + Intergenic
960041690 3:113156356-113156378 AATTGTACACTTAAAATGAGTGG + Intergenic
960348918 3:116570141-116570163 AATTTTACATTTTAAATGGGTGG - Intronic
960587844 3:119336677-119336699 ACTTGTATACTTTAAATAGGTGG - Intronic
961225370 3:125240049-125240071 AATTATACATTTTAAATGGGTGG + Intronic
961764883 3:129201918-129201940 AATTGTACATTTTAAAAGGGTGG - Intergenic
963304324 3:143633959-143633981 AACTGTTGCCTTTATATTGGAGG + Intronic
963702074 3:148638977-148638999 AACTGTACACTTTAAATTCATGG + Intergenic
964401948 3:156308984-156309006 ATTTTTTCCCTTTTAATTGGGGG + Intronic
964730276 3:159857468-159857490 AAGTGTACACTTTAAAAAGGTGG - Intronic
964877642 3:161386776-161386798 AAATGAACCCTTTAAAATGAAGG - Intergenic
965311884 3:167138733-167138755 AATTGTACACTTTAAAAGTGTGG + Intergenic
965719674 3:171647743-171647765 AACTGTACACTTAAAAATGGGGG - Intronic
967015274 3:185475997-185476019 AACTATACACTTTAAATGGGAGG - Intronic
970017970 4:11533951-11533973 AATCATACCCTTTAAAAAGGTGG - Intergenic
971699353 4:29949507-29949529 AATTGTACCTTTTAAAATAACGG + Intergenic
972448555 4:39171702-39171724 AATTGCACACTTTTAAATGGTGG - Intergenic
972502163 4:39688530-39688552 AATTGTACACTTTAAATAGGTGG - Intergenic
972683225 4:41327013-41327035 AGTTGTATATTTTAAATTGGTGG + Intergenic
972686201 4:41356046-41356068 ACTTGTACACTTTAAATAGCTGG + Intergenic
972861531 4:43174652-43174674 AATTATACTCTTTAAATGGATGG + Intergenic
972965842 4:44508552-44508574 AATTCTGCCCTTTAAAGTGCTGG + Intergenic
972986156 4:44768546-44768568 GATTGTACACTTAAAATGGGGGG + Intergenic
973227196 4:47800209-47800231 AATTGTAGACTTTAAATGGTTGG + Intronic
974978294 4:68919688-68919710 AATTTTACACTTTAAATAGGTGG + Intergenic
975191207 4:71464747-71464769 AATTCCACCCTTAAAATAGGAGG + Intronic
975997976 4:80338408-80338430 AATTGTAAACTGTAAATTAGAGG + Intronic
976268146 4:83204705-83204727 AATTGAACCCTTTTTACTGGGGG - Intergenic
976409679 4:84699083-84699105 CATTGTTCCCTTTAAATGGCTGG - Intronic
976512448 4:85927456-85927478 AATTGTACATTTTAAACTGGGGG + Intronic
976860602 4:89661427-89661449 ATGTAAACCCTTTAAATTGGAGG - Intergenic
976932387 4:90583943-90583965 AATTGTACCTTTTATATTATTGG - Intronic
977704579 4:100057046-100057068 ACTGGTACCTTTTAAATTAGGGG + Intergenic
978170233 4:105660860-105660882 AATTGTATACTTTAAATAGGTGG - Intronic
978935808 4:114373897-114373919 AATCACACCCTCTAAATTGGTGG + Intergenic
979221288 4:118228616-118228638 AATTGTACATTTAAAATGGGTGG - Intronic
980637580 4:135528250-135528272 AATTGTACTCTTTATATTTTTGG + Intergenic
981246418 4:142545032-142545054 AAATCTACATTTTAAATTGGAGG + Intronic
982118696 4:152118737-152118759 AAATGTAACCTTTAATTTGAAGG - Intergenic
982351759 4:154423095-154423117 AAGTGTACAGTTTAAATGGGTGG - Intronic
983653014 4:170052490-170052512 AATTGTACATTTTAAATGGGTGG - Intergenic
983807458 4:172012825-172012847 CATTGTACACTTAAAATTTGTGG - Intronic
984062474 4:175007519-175007541 AATTGTACCTGTTAAATAGCTGG + Intergenic
989470484 5:41811713-41811735 ATTTGCAACCTTTAAAATGGTGG + Intronic
989755006 5:44941404-44941426 AATTTTAACATGTAAATTGGCGG + Intergenic
989979765 5:50629592-50629614 AAATTTACCCTTTAATTTTGGGG + Intergenic
991190926 5:63872442-63872464 AAAGGTACACTTGAAATTGGAGG + Intergenic
991714096 5:69435359-69435381 AATTGTACACTTTAAAAGGGTGG - Intronic
991968195 5:72112327-72112349 AATTTTAGCTTTTAAATGGGAGG + Intronic
992330145 5:75708579-75708601 AAATGTACATTTGAAATTGGGGG - Intronic
993309476 5:86311566-86311588 AATTATAACCTTTAAAGTTGAGG + Intergenic
993657103 5:90591503-90591525 AATTGTTCACTTTAAATTGTAGG + Intronic
995402577 5:111758353-111758375 AATTGTACTTTTTAAAATCGAGG + Intronic
995778571 5:115751704-115751726 AAATATACTCTTTAAAATGGTGG - Intergenic
996704395 5:126482293-126482315 AATTGTATACTTTTAAATGGTGG + Intronic
996772530 5:127100024-127100046 AATTGTAGGCTTTAAAATGAAGG - Intergenic
996887427 5:128374234-128374256 AATTGTACACTTTAAAGTGATGG - Intronic
996971041 5:129368166-129368188 AATTGTACACTTTAAATGGGTGG + Intergenic
997147007 5:131445842-131445864 AATTGTACATCTTAAATTGTAGG - Intronic
997516245 5:134491893-134491915 ATTTGTACCCTATAGATTGGGGG - Intergenic
999843314 5:155452007-155452029 GATTTTACCCTGTAAGTTGGTGG + Intergenic
999861532 5:155652728-155652750 AATTTTACACTTTAAATGAGTGG - Intergenic
1000620820 5:163484627-163484649 AATTGTCCACTTTCAATGGGTGG - Intronic
1001509362 5:172308167-172308189 CATTGTACACTTTAAATGGGTGG + Intergenic
1001640375 5:173239535-173239557 AACTGTATACTTTAAATGGGTGG - Intergenic
1001809466 5:174616929-174616951 AATTGTACCATTAAAATTCTTGG + Intergenic
1002356709 5:178635645-178635667 AGTTGTACCCTCTGCATTGGAGG - Intergenic
1004746768 6:18517112-18517134 AATTGTTCACTTTAAATATGTGG - Intergenic
1006532017 6:34663697-34663719 AATTGTACAATTGAAATGGGTGG - Intronic
1007112900 6:39323460-39323482 AATTGCACACTTTAAATGTGTGG - Intergenic
1008984053 6:57520679-57520701 AACTATACCCTTTAAACGGGTGG - Intronic
1009172111 6:60413587-60413609 AACTATACCCTTTAAATGGGTGG - Intergenic
1009364520 6:62847710-62847732 TATTGTACCTTATATATTGGAGG - Intergenic
1012024265 6:93968119-93968141 AAATGTGCCCTTTAAGTAGGAGG - Intergenic
1013350704 6:109303118-109303140 AATTGTATTCTTTAAATCAGGGG - Intergenic
1018158613 6:161014776-161014798 ATTTGGACACTTTAAATGGGTGG - Intronic
1021659495 7:22905520-22905542 ATTTGTCCCCTTCAAATCGGTGG - Intergenic
1022392339 7:29954367-29954389 AACTGTACAGTTTAAATGGGTGG - Intronic
1023477745 7:40599296-40599318 AATTGTTCGCTGTAAATTGAAGG + Intronic
1023991051 7:45128959-45128981 AATTGTACACTTTACAATTGGGG - Intergenic
1024390298 7:48803071-48803093 AATTGTACCTTTTAAATTGGTGG + Intergenic
1025254173 7:57372271-57372293 AACTGTACACTTTAAATCAGAGG - Intergenic
1025297438 7:57787233-57787255 AATTTTACACTTTAAATCAGTGG + Intergenic
1027035610 7:74922960-74922982 AATTATACCCTTGAACTTGCAGG + Intergenic
1027156376 7:75771219-75771241 AATTATAGCCTTTAAATTGGTGG - Intronic
1028390338 7:90309454-90309476 AATTTTACCCATTAAATGGATGG + Intronic
1028627325 7:92891929-92891951 AATTGTACACTTTAAATACAGGG - Intergenic
1030104613 7:105976479-105976501 AATTGTACAATTTAAATGGCTGG - Intronic
1031067955 7:117127521-117127543 AGTTATGCCCTTTAAATTGAAGG - Intronic
1031841748 7:126750436-126750458 AATTGTACACTTGAAATTGATGG + Intronic
1032026926 7:128450495-128450517 AATTGTATCCTTTAAAACGGTGG - Intergenic
1032381311 7:131485149-131485171 AAATGTACCCATTAATTTTGGGG - Intronic
1032594306 7:133224223-133224245 AATTGTACACTTAAAAATGGTGG + Intergenic
1032652816 7:133896969-133896991 CATTGTCCCCTTTAAATAGTGGG - Intronic
1033183684 7:139205354-139205376 AAATGTACATTTTAAATAGGTGG + Intergenic
1034704742 7:153130550-153130572 ACTTGTACACTTTAAATGGGTGG - Intergenic
1035090179 7:156303898-156303920 AATTGTACACTTTTAAGGGGTGG + Intergenic
1035176144 7:157052603-157052625 AATTGTACAGTTTAAATGGATGG + Intergenic
1036439524 8:8768119-8768141 AATTGTATACTTTAAAAGGGTGG - Intergenic
1041252708 8:55949792-55949814 AATTGTACACTTTAAGTAGATGG - Intronic
1042236562 8:66619110-66619132 AATTGTACACTTTAAATGAATGG - Intergenic
1042828535 8:73002567-73002589 AATTGTACCCCTAAAATGGTTGG - Intergenic
1042859309 8:73296451-73296473 AAATGTACCATTTTCATTGGTGG + Intronic
1043930608 8:86086634-86086656 AATTGCACACTTTAAATGGTTGG + Intronic
1043996551 8:86824779-86824801 TATTGTACCCATGAAGTTGGGGG + Intergenic
1045239404 8:100385918-100385940 AAGTGTACACTTTAACGTGGTGG + Intronic
1045986170 8:108251950-108251972 AACTGTATACTTTAAATGGGTGG - Intronic
1046416856 8:113927523-113927545 AATTGTACCATTTAAATTATTGG - Intergenic
1046479552 8:114797837-114797859 AATTGTACCCCTAAAAGAGGAGG + Intergenic
1046560462 8:115830856-115830878 AATACTACCATTTAATTTGGAGG + Intergenic
1047158292 8:122347149-122347171 AACTGTACACTTTAAAATGATGG + Intergenic
1048590864 8:135819538-135819560 AATTTTTCCTTTTAAATTGATGG + Intergenic
1048691541 8:136970269-136970291 TATTTTACACTTTAAGTTGGGGG + Intergenic
1049082780 8:140456440-140456462 AATTGTACACTTTAAAGCAGTGG + Intronic
1050382502 9:5043914-5043936 AATTTTACACTTTAAGTGGGTGG + Intronic
1050951744 9:11605145-11605167 AATTGTAACCCTACAATTGGGGG - Intergenic
1051379742 9:16443926-16443948 GATTGTACACTTAAAATTGGCGG + Intronic
1052531864 9:29695406-29695428 AATTTTACTGTTTAAATTTGTGG - Intergenic
1052761376 9:32595588-32595610 AACTATACACTTTAAATTGCTGG + Intergenic
1053224738 9:36344317-36344339 AATTGTACATTTTAAATGAGTGG + Intronic
1053796174 9:41728802-41728824 AATTTTACACTTTAAATCAGTGG - Intergenic
1054149008 9:61586069-61586091 AATTTTACACTTTAAATCAGTGG + Intergenic
1054184579 9:61940872-61940894 AATTTTACACTTTAAATCAGTGG - Intergenic
1054468774 9:65517179-65517201 AATTTTACACTTTAAATCAGTGG + Intergenic
1054653928 9:67647625-67647647 AATTTTACACTTTAAATCAGTGG + Intergenic
1055391757 9:75829239-75829261 AATTGTACCCTTTAAAAGGTGGG + Intergenic
1056512623 9:87320275-87320297 AGTTGTATCCTGTAACTTGGAGG + Intergenic
1057583530 9:96308908-96308930 AACTGTACACTTAAAATTGCTGG + Intergenic
1057585309 9:96323554-96323576 AATTATAACTTTTAAGTTGGGGG - Intronic
1057846134 9:98526114-98526136 AATTGTATGCTTTAAAATGGTGG + Intronic
1058013947 9:100009042-100009064 AATTGTACACTTAAAAATGATGG - Intronic
1058431625 9:104926044-104926066 AATTCCACTCTTTAACTTGGGGG + Intronic
1058781324 9:108338356-108338378 AATTTTAAAATTTAAATTGGAGG + Intergenic
1060273251 9:122162935-122162957 AATTGTACACTTTAAACACGTGG + Intronic
1061030290 9:128077756-128077778 AACTGTATACTTTAAATGGGTGG + Intronic
1061676466 9:132218961-132218983 AATTGTACGCTTTACATGTGTGG - Intronic
1062595937 9:137299265-137299287 AAGTGTATCTTGTAAATTGGGGG - Intergenic
1187532762 X:20111712-20111734 AATTGTGCATTTTAAATGGGTGG + Intronic
1189137512 X:38563938-38563960 AATCGTATACTTTAAATAGGTGG - Intronic
1189287830 X:39864799-39864821 ACTTGTACACTTAAGATTGGTGG + Intergenic
1189467283 X:41286923-41286945 AATTATACACTTTAAATGGGTGG + Intergenic
1189614261 X:42767816-42767838 AATTGAACCTTTTTAACTGGGGG - Intergenic
1190395030 X:49973586-49973608 AATTGTACACTTTAAATGGGTGG - Intronic
1190779555 X:53580192-53580214 AATTGTATCTGTTAAATTTGGGG - Intronic
1191624407 X:63254621-63254643 AACTGTATACTTTAAATGGGTGG + Intergenic
1192466581 X:71361090-71361112 AATTGTACACTTGAAATGGGTGG - Intergenic
1193656534 X:84205145-84205167 AATTTTCCCCTTTGAACTGGTGG + Intergenic
1193696434 X:84712288-84712310 ACTTGAACCCTGTAAGTTGGAGG - Intergenic
1194005250 X:88483913-88483935 AATTGTAAATTTTAAATTGTTGG - Intergenic
1195398208 X:104434023-104434045 ATTTGTTCCCCTTACATTGGGGG - Intergenic
1195742490 X:108079167-108079189 AATTGTACACTTTAAATGTCTGG - Exonic
1195790471 X:108579034-108579056 AATTGTACACTTTAAATGGGTGG - Intronic
1195955358 X:110323271-110323293 AATTGTAAAATTTAAATGGGTGG - Intronic
1196195780 X:112837660-112837682 AATTCTAACCTTTGACTTGGGGG + Intronic
1196228436 X:113192932-113192954 AATTCTACACCTTAAAATGGTGG + Intergenic
1196993153 X:121349996-121350018 AATTATAACCTTTAGATTGATGG + Intergenic
1197324511 X:125075530-125075552 AATTGTACATTTTAAATGAGTGG - Intergenic
1197375640 X:125678678-125678700 AGTTGTACTCTTTAGAATGGTGG - Intergenic
1197945746 X:131837971-131837993 CATTGTACATTTTAAATTGGTGG + Intergenic
1198171723 X:134113041-134113063 AATTGTACTCTTTAAAAGGGTGG - Intergenic
1198201960 X:134430695-134430717 AATTATACCCTTTAAAAGAGTGG + Intergenic
1199473689 X:148222827-148222849 AATTGTAGACTTTAAATGGGTGG - Intergenic
1199583753 X:149389198-149389220 AATTTTACACTTTAAATGAGTGG + Intergenic